Abbreviations
PCR: Polymerase chain reaction
NCBI: National Center for Biotechnology Information
MR: Methyl red, VP: Voges Proskauer
BLAST: Basic local alignment search tool
Introduction
Aquaculture is currently the fastest-growing sector of food-animal production globally [1]. In 2022, global aquaculture production reached approximately 130.9 million tons, significantly contributing to food security, especially in food-insecure regions [2] . The industry also supports the livelihood of millions of people worldwide [3]. According to World Bank (2024) classification, the total share of fisheries and aquaculture harvested by non-high-income countries in recent decades has increased from about 33 % in the 1950s to 84 % in 2022, Of this total production, the upper-middle-income countries contributed 56 %, lower-middle-income countries 26 %, high-income countries 16 % and low-income countries 2 % [3] . Global fish production is estimated to reach approximately 196 million tons by 2025 accounting for about 17.3 % of the total consumption of animal protein worldwide. In 2017, fish represented about 6.8% of the total animal protein consumption, with a per capita consumption estimate of 20.3 kg. This provides about 20 % of average per capita animal protein diet for nearly 3.3 billion people, and contributes at least 10 % of such protein intake for 5.6 billion people [4] .
Finfish species such as tilapia and catfish are affordable sources of animal protein, and by-products [5]. They also serves as a source of income for low-income populations in rural, developing or undeveloped areas [6] . These species are known generally to occupy various habitats (freshwater, brackish or marine) and come in diverse shapes, sizes and biological adaptations.
Despite these benefits, infectious diseases remain a major setback to the aquaculture industry. They result in great economic losses due to fish mortality, poor marketability, increased treatment cost and potential zoonotic disease transmission [7] .
Among bacteria pathogens Pseudomonas species stand out as gram-negative opportunistic bacteria, with high adaptability to survive in various environmental conditions, including the aquaculture environment [8]. Numerous species of Pseudomonas are known to be pathogenic for Aquatic and other animals including humans [9]. Pseudomonadiasis is one of the most prevalent diseases in global aquaculture [10] , causing severe economic losses and decreased fish farming efficiency [11]. It has been reported to be among the most common diseases of fish, causing almost 100 % mortality in some cases [12] . Although many Pseudomonas spp have been described as opportunistic pathogens, several species including P. putida, P. fluorescence, P. aeruginosa, P. anguilliseptica, P. baetica, P. chlororaphis, P. koreensis, P. luteola, P. plecoglossicida, and P. pseudoalcaligenes were identified to be the primary pathogens of several disease cases of farmed fish [8,9]..
In regions like Nigeria, limited information about the exact pathogen responsible for fish diseases hampers the implementation of effective preventative and control measures [7,10]. Therefore, species-specific detection of Pseudomonas may help for establishing a more complete understanding of their pathological significance [13] . Molecular detection could also guide researchers to gain a clear understanding of the ecological impact of the pathogen and also overcome the deficiencies of the traditional approaches.
Given the limited literature and data on the molecular characterization of important microorganisms of fish and environmental health concerns from the study area, this study is the first of its kind in Kano, Nigeria. The present study aim to describe the phenotypic and genomic characteristics of pathogenic Pseudomonas species isolated from two fish species, Oreochromis niloticus and Clarias gariepinus, sold at the Galadima fish market in Kano metropolis, Nigeria.
Results
Pseudomonas species isolation rates
In this study, three Pseudomonas species (P. fluorescensP. aeruginosa and P. putida) reported to be fish pathogens were isolated and characterized. The overall isolation rate of pathogenic Pseudomonas from all the samples was 6 (7.5 %) after molecular characterization (5 % P. putida, 1.25 % P. aeruginosa and 1.25 % P. fluorescens) (Table 1).
| Isolate | Clarias gariepinus | Oreochromis niloticus | Total (%) |
| P. putida | 3 | 1 | 4 (5) |
| P. fluorescens | 1 | 0 | 1 (1.25) |
| P. aeruginosa | 1 | 0 | 1 (1.25) |
| Total | 5 | 1 | 7.5 |
Pseudomonas fish species-specific isolation rates
The isolation rate from the African catfish (Clarias gariepinus) was 5 (12.5 %) while the specific isolation rates from the gills, liver, spleen and intestine were 3 (40 %), 0 %, 0 (0 %), 2 (20 %) respectively (Table 2). The isolation rate from the Tilapia (Oreochromis niloticus) was 1 (2.5 %) while the specific isolation rate from the gills, liver, spleen and intestine were 0 %, 0 %, 1 (10) %, 0 % respectively (Table 2). Table 2 shows the isolation rate in different parts of C. gariepinus and O. niloticus from the market. There was significant difference in the isolation rate between C. gariepinus and O. niloticus (p< 0.05).
| Organs examined | Clarias gariepinus | Oreochromis niloticus | ||
|---|---|---|---|---|
| Isolation rate (out of 10) | % | Isolation rate (out of 10) | % | |
| Gills | 4 | 40 | 1 | 10 |
| Liver | 0 | 0 | 0 | 0 |
| Spleen | 1 | 10 | 1 | 10 |
| Intestine | 2 | 20 | 0 | 0 |
| Total (out of 40) | 7 | 17.5 | 2 | 5 |
Organ-Specific isolation rates of Pseudomonas
There were a significant difference in the isolation rate between the various body parts across both fish species (p< 0.05). The gills of C. gariepinus exhibited the highest rate of contamination, with an isolation rate of 30%. The gills and intestine are the only parts of the C. gariepinus contaminated, the intestine followed with a 20 % isolation rate. For the spleen, the isolation rate from the C. gariepinus was 0 % and 10 % from the O. niloticus. No Pseudomonas species were isolated in all the liver samples from both C. gariepinus and O. niloticus. Overall, the gills and intestines were the primary sites of Pseudomonas presence in C. gariepinus, while the spleen was the only contaminated site in O. niloticus. The gills samples from C. gariepinus had a higher isolation rate (30 %) than the O. niloticus (0 %). Similarly, the intestine of C. gariepinus had a higher isolation rate (20 %) than the O. niloticus (10 %). However, the spleen samples from O. niloticus had a higher isolation rate (10 %) than the C. gariepinus (%)(Table 3).
| Organs examined | Clarias gariepinus | Oreochromis niloticus | ||
|---|---|---|---|---|
| Isolation rate | % | Isolation rate | % | |
| Gills | 3 | 30 | 0 | 0 |
| Liver | 0 | 0 | 0 | 0 |
| Spleen | 0 | 0 | 1 | 10 |
| Intestine | 2 | 20 | 0 | 0 |
| Total | 5 | 12.5 | 1 | 2.5 |
Discussion
Fish and fishery products are vital for global nutrition and food security. Nonetheless, they are highly perishable, with quality influenced by species differences, feeding habits, and environmental conditions [15] . Improperly processed or raw fish can act as vehicle for pathogenic microorganisms, posing notable public health risks [16] . Among these, Pseudomonas spp are recongnised as important opportunistic pathogens in fish, with the potential to cause disease in humans while also serving as indicators of fish quality and safety [9] . In this study we established to species level the occurrence of the fish pathogen (Pseudomonas spp) of public health importance with an overall prevalence of 6 %.
Masbouba [17] reported a higher isolation rates, 36.9 % for P. fluorescens and 29.1 % for P. aureginosa, from diseased Clarias gariepinus. The elevated isolation rates in that study may be attributed to sampling clinically infected fish from an outbreak on a farm. Olayemi et al. [18] isolated P. aerugenosa from the gills of C. gariepinus in Ile-Ife, Nigeria.
The presence of Pseudomonas in the spleen, intestine and gills of fish (C. gariepinus and O. niloticus) sampled from the Galadima fish market in Kano metropolis showed bacterial contamination. This cause for concern, as P. putida and P. fluorescens are known to cause septicemia in fish. Their infections often resemble motile Aeromonas septicemia especially in stressed fish stocks [19 , 20]. As fish serve as an affordable source of protein, such contamination poses a serious health hazard to humans and may serve as zoonosis risks to consumers [21] .
Interestingly, the findings of this study differs considerably from those of a similar investigation in Khartoum, where isolation rates of Pseudomonas from gills and intestines were 63 % and 31 % respectively [22] . The differences in isolation and characterization methodologies, sample origin, hygienic practices and the different sources of water and its quality may have contributed to the differing results. Moreover, the higher isolation rates in the previous study may be associated with clinical infections in fish populations.
Fisheries are vital to food security, livelihoods, and economic growth in many Africa nations, including Nigeria [21 , 23]. The study's findings indicate that fish in Kano region are susceptible to Pseudomonas infections. These infections have the potential to degrade fish quality, higher growth rates, increase mortality, and ultimately reduce profit margins for fish farmers. Additionally, managing such infections often requires antibiotic treatment, which raises production costs [24] .
Pseudomonas species are particularly concerning due to their resistance to multiple antibiotics. In Nigeria, the regulation of antibiotic use in aquaculture is weak, increasing the risk of antimicrobial resistance (AMR) [25] . This issue threatens not just local aquaculture sustainability but also feeds into the global AMR crisis. The situation becomes even more alarming when Pseudomonas infections are transmitted to humans [26] . The risk escalates when Pseudomonas infections are transmitted to humans, P. aeruginosa is an opportunistic human pathogen and can pose serious health risks, especially to immunocompromised individuals, through the handling or consumption of contaminated fish [27] .
In conclusion, the detection of P. putida, P. aeruginosa and P. fluorescens in fish from Kano, Nigeria, underscores the need for improved public awareness and deeper understanding of pathogenic bacterial infections in aquaculture. Enforcing strict hygienic control protocols, implementing preventive strategies, and promoting effective biosecurity practices are essential steps toward safeguarding healthy aquaculture environments
Materials and Methods
Study Area
This study was conducted at Galadima market, located in Fagge Local Government Area of Kano state, Nigeria (Latitude 12.0127° N and longitude 8.5344° E) [14]. Galadima Market is the largest hub for fresh fish in the region, where farmers supply fresh fish for wholesale and retails from the wild and in captivity (aquaculture) for consumption.
Study design
The aim of this research was to isolate Pseudomonas species of medical importance from two major fish species freshly brought for sale at the Galadima fish market in the Kano metropolis. A total of 80 tissue samples were collected, comprising the gills, liver, spleen, and intestine, from 20 fish specimens (10 Clarias gariepinus and 10 Oreochromis niloticus). Their morphometric measurements were also recorded (Table 4). Samples were cultured on Nutrient agar and and bacterial isolates were subjected to biochemical characterization followed by molecular identification through DNA sequencing.
| S/N | Fish Species | Total Length (cm) ± SD | Total Weight (g) ± SD | Standard Length (cm) ± SD |
|---|---|---|---|---|
| 1 | Oreochromis niloticus (range) | 39.07 ± 5.52 (26.1 - 49.6) | 589.23 ± 233.9 (140 - 1150) | 36.27 ± 5.23 (22.15 - 47.2) |
| 2 | Clarias gariepinus (range) | 41.29 ± 3.44 (35.0 - 48.2) | 658.94 ± 174.2 (353.2 - 1020.5) | 39.0 ± 3.45 (33.3 - 46.0) |
Culture and Bacterial isolation
Culture, isolation and identification of bacteria were carried out based on the method described by [8]. Each sample was inoculated on Nutrient agar and incubated at 37ºC for 24 hours. The growths were subjected to Gram staining and biochemical test for further identification.
The inoculation Media was prepared based on the manufacturer's instructions. A sterilized spatula was used to cauterize the surface of the sample. The cauterized surface was then cut using sterilized scissors. A swab stick was then inserted deep into the cut tissue sample to collect samples for primary smear preparation. Secondary and tertiary smear were made using a sterilized wire loop. The samples were incubated at 37°C for 24 hours. Plates were examined for bacterial growth, subcultured and re-incubated at 37ºC for another 24 hours. Colonial morphology was then studied (Figure 1). All isolates were preserved and later sent to South Africa for DNA sequencing.

Figure 1.Pseudomonas on nutrient agar
Biochemical characterisation
Biochemical tests were conducted after the colony morphology assessment, assessment to further characterize the isolates (Figure 2). Standard conventional biochemical assays, included Gram staining, urease, citrate, catalase activities and oxidase, Indole, Methyl red (MR), Voges Proskauer (VP) and motility tests were carried out [8] . The test tubes containing the test media were labeled and arranged properly in a test tube rack, each was inoculated with an inoculum of the isolates and incubated at 37°C for 24 hours. After incubation, reagents such as Kovac's, VP1 and VP2 were added to the incubated peptone water for both Indole and MRVP tests respectively Reaction were recorded accordingly (Table 5) and DNA was extracted from confirmed isolates for sequencing.

Figure 2.Biochemical identification of Pseudomonas species
| S/N | Test | Pseudomonas spp |
|---|---|---|
| 1. | Gram reaction | - |
| 2. | Oxidase | + |
| 3. | Indole | - |
| 4. | Methyl red | - |
| 4. | Voges-proskauer | - |
| 5. | Citrate | + |
| 6. | Catalase | + |
| 7. | Urease | - |
| 8. | Motility | + |
Extraction of genomic DNA, amplification by PCR and Sequencing
The confirmed isolates were sent to Inqaba Biotec™ (Pretoria, South Africa) for PCR, agarose gel electrophoresis and Sanger sequencing. Genomic DNA was extracted using the QIAamp DNA kit (Qiagen, Germany). DNA concentration and purity were assessed before molecular analysis. Primer selection, PCR amplification, purification of the amplified products, DNA sequencing and the sequence analysis were performed as described by Duman et al., 2021 [8].
PCR amplication targeted universal primer 16S rRNA (small subunit ribosomal RNA) gene using the primers listed in Table 6.
| Universal primer set used for PCR amplification. | Target | Sequence (5' to 3') |
|---|---|---|
| 16S-27F | 16S rDNA sequence | AGAGTTTGATCMTGGCTCAG |
| 16S-1492R | 16S rDNA sequence | CGGTTACCTTGTTACGACTT |
Figure 3 is a gel image showing position and base pairs for the different Pseudomonas species.

Figure 3.Gel image showing position and base pairs for the different Pseudomonas species. Keys: C= Clarias gariepinus; O= Oreochromis niloticus; M= Molecular ladder: C1 = P. putida, C2= P. putida, C3= P. fluorescen, C4= P. putida, C5= P. aeruginosa, O1 = P. putida.
Species level identification was performed using sequencing of DNA dependent RNA polymerase subunits. The sequences obtained from the sequencing were analyzed and aligned. By BLAST the homologous searches were done from the results of the sequencing. The nucleotide sequence of the PCR product showed 99.29, 99.22, 94.81 % and 94.72 Pseudomonas putida, 96.52 % Pseudomonas aeruginosa and 94.72 % Pseudomonas fluorescens respectively. The results revealed similarity levels to published Pseudomonas species sequences in the NCBI database.
Authors' Contributions
A, B, and C conceived, designed and supervised the experiment
A, B, D, E, H and I collected and prepared the samples for the experiment
C, D, E, F, G, H and I conducted the experiment
D, G and F analysed and interpreted the results
A, B, C, F and E led the writing of the manuscript.
All authors contributed significantly to the success of the experiment, analysis and manuscript writing.
Acknowledgements
The authors acknowledge and thank the management and staff of the Biotechnology Laboratory, Center for Dryland Agriculture, Bayero University, Kano Nigeria.
Conflict of interest
The authors declare that there is no conflict of interest.
References
- FAO. 2024. G20 backs FAO's Blue Transformation for sustainable fisheries and aquaculture, highlights family farming. FAO Newsroom, 2024.
- Usman MD, Wakawa AM, Musa A, MT Ahmad, Ahmad KH, Muazu TA, Musa AZ, Atabo, SM. Occurrence of hemolytic Escherichia coli, antimicrobials residue in cultured Clarias gariepinus and assessment of antimicrobial use among catfish farmers in Kano metropolis, Nigeria. Journal of Sustainable Veterinary & Allied Sciences. 2022;2(2):105-113.DOI
- FAO 2024a. FishStat. Global production by production source 1950-2022. [Accessed on 29 March 2024]. In: FishStatJ. Available at: www.fao.org/fishery/en/statistics/software/fishstatj. License: CC-BY-4.0.
- Sudheesh PS, Al-Ghabshi A, Al-Mazrooei N, Al-Habsi S. Comparative Pathogenomics of Bacteria Causing Infectious Diseases in Fish. International Journal of Evolutionary Biology. 2012 May; 2012(1):45726.DOI
- Akinjogunla VF, Shu'iabu U. Ichthyofauna Composition and Operative Artisanal Fishing Activities in Ajiwa Irrigation Dam, Katsina State, Northern Nigeria. Journal of Innovative Research in Life Sciences. 2022;4(1):45-53.
- Akinjogunla VF, Yah CS, Akinjogunla OJ, Ayanwale AV, Adefiranye OO, Ejikeme CE. A Comparative Assessment of Morphometrics and Microbial Assemblages of Crassostrea gasar (Oyster) from Riparian Swampy Areas, off Lagos Lagoon, Nigeria. Tropical Journal for Natural Products Research. 2023 ;7(10):2837–2845.DOI
- Usman MD, Wakawa AM, Musa A, Ahmad KH, Isiaku A. Occurrence of multi-drug resistant Enterobacteriaceae in cultured Clarias gariepinus (African catfish) in Kano metropolis, Nigeria. Sokoto Journal of Veterinary Sciences. 2021 ;19(2):106-111.DOI
- Magdy IH, El-Hady MA, Ahmed HA, Elmeadawy SA, Kenwy AM. A contribution on Pseudomonas aeruginosa infection in African catfish (Clarias gariepinus). 2014 ;575-588.
- Duman M, Mulet M, Altun S, Saticioglu IB, Ozdemir B, Ajmi N, Lalucat J and García-Valdés E. The diversity of Pseudomonas species isolated from fish farms in Turkey. Aquaculture. 2021;535:736369.DOI
- Irshath AA, Rajan AP, Vimal S, Prabhakaran VS, Ganesan R. Bacterial pathogenesis in various fish diseases: recent advances and specific challenges in vaccine development. Vaccines. 2023;11(2):470.DOI
- Shabana BM, Elkenany RM, Younis G. Sequencing and multiple antimicrobial resistance of Pseudomonas fluorescens isolated from Nile tilapia fish in Egypt. Brazilian Journal of Biology.DOI
- Thomas J, Thanigaivel S, Vijayakumar S, Acharya K, Shinge D, Seelan TSJ, Mukherjee A, Chandrasekaran N. Pathogenecity of Pseudomonas aeruginosa in Oreochromis mossambicus and treatment using lime oil nanoemulsion. Colloids and Surfaces B: Biointerfaces. 2014;116:372-377.DOI
- Tripathy S, Kumar N, Mohanty S, Samanta M, Mandal RN, Maiti NK. Characterisation of Pseudomonas aeruginosa isolated from freshwater culture systems. Microbiological Research. 2007;162(4):391-396.DOI
- National Population Census. National Population Commission Office, Kano. Kano State, Nigeria. 2006.
- Derome N, Filteau M. A continuously changing selective context on microbial communities associated with fish, from egg to fork. Evolutionary Applications. 2020;13(6):1298-319.DOI
- Jennings S, Stentiford GD, Leocadio AM, Jeffery KR, Metcalfe JD, Katsiadaki I, Auchterlonie NA, Mangi SC, Pinnegar JK, Ellis T, Peeler EJ. Aquatic food security: insights into challenges and solutions from an analysis of interactions between fisheries, aquaculture, food safety, human health, fish and human welfare, economy and environment. Fish and Fisheries. 2016;17(4):893-938.DOI
- Masbouba IM. Studies on Pseudomonas Infection in Fish in Kafr El - Sheikh Province. Unpublished M V Sc. Thesis, Tanta University. 2004.
- Olayemi OO, Adenike K, Ayinde AD. Evaluation of antimicrobial potential of a galactose-specific lectin in the skin mucus of African catfish (Clarias gariepinus, Burchell, 1822) against some aquatic microorganisms. Research Journal of Microbiology. 2015;10(4):132.DOI
- Attia MM, Abdelsalam M, Elgendy MY, Sherif AH. Dactylogyrus extensus and Pseudomonas fluorescens dual infection in farmed common carp (Cyprinus carpio). Microbial Pathogenesis. 2022;1;173:105867.DOI
- Mishra SS, Das R, Sahoo SN, Swain P. Biotechnological tools in diagnosis and control of emerging fish and shellfish diseases. InGenomics and biotechnological advances in veterinary, poultry, and fisheries. 2020;1;311-360.DOI
- Luqman M, Hassan HU, Ghaffar RA, Bilal M, Kanwal R, Raza MA, Kabir M, Fadladdin YA, Ali A, Rafiq N, Ibáñez-Arancibia E. Post-harvest bacterial contamination of fish, their assessment and control strategies. Brazilian Journal of Biology. 2024 ;1;3;84:e282002.DOI
- Yagoub SO. Isolation of Enterobacteriaceae and Pseudomonas spp. from raw fish sold in fish market in Khartoum state. Journal of Bacteriology Research. 2009;1(7):85-8.
- Maulu S, Musuka CG, Molefe M, Ngoepe TK, Gabriel NN, Mphande J, Phiri M, Muhala V, Macuiane MA, Ndebele-Murisa MR, Hasimuna OJ. Contribution of fish to food and nutrition security in Southern Africa: challenges and opportunities in fish production. Frontiers in Nutrition. 2024; 11:1424740.
- Chubado A. The role of fisheries resources in economic development and job creation in Nigeria. J Aqua Fish. 2021; 2(5):1-1.
- Irshath AA, Rajan AP, Vimal S, Prabhakaran VS, Ganesan R. Bacterial pathogenesis in various fish diseases: recent advances and specific challenges in vaccine development. Vaccines. 2023;11(2):470.DOI
- Dauda AB, Nababa AS, Oshoke JO, Salele HA, Odetokun IA, Bello OM, Dasuki A. Antibiotics Use and Awareness of Risks Associated with Antimicrobial Resistance Among Fish Farmers in Katsina State, Nigeria.
- Magdy IH, El-Hady MA, Ahmed HA, Elmeadawy SA, Kenwy AM. A contribution on Pseudomonas aeruginosa infection in African catfish (Clarias gariepinus).