Introduction
Actinomycetes, particularly members of the genus Streptomyces, represent a significant group of Gram-positive bacteria renowned for their capacity to produce a diverse array of bioactive secondary metabolites, including many clinically relevant antibiotics. These metabolites are crucial in pharmaceutical applications, especially in addressing the escalating issue of antibiotic resistance by providing new compounds for drug development [1].
Actinomycetes' ecological diversity facilitates their thriving in various environments, contributing to their ability to produce different classes of bioactive compounds such as antibacterials, antifungals, and anticancer agents [2]. Notably, actinomycetes account for approximately 45% of all known bioactive microbial metabolites, with over 10,000 compounds reported [3]. Their unique chemical structures and biological activities render them invaluable in the search for new therapeutic agents [4].
Actinomycetes inhabit various ecological niches, with soil and organic matter serving as key reservoirs. They thrive in diverse environments, including marine ecosystems, freshwater habitats, and extreme conditions such as deserts and high-salinity areas [5]. Furthermore, actinomycetes have been isolated from unique habitats like mangrove forests, caves, and endophytic niches within plants, underscoring their adaptability and ecological significance [6,7]. These microorganisms engage in complex interactions within their ecosystems, significantly influencing their metabolite production. Understanding the ecological context of actinomycetes is essential for discovering novel bioactive compounds, as their secondary metabolites are often linked to environmental interactions [8]. The ongoing exploration of these diverse habitats continues to unveil new actinomycete species with potential therapeutic applications [9].
Sheep feces, rich in organic nutrients, provide an optimal environment for the growth of actinomycetes, thereby promoting their metabolic diversity. The nutrient composition of sheep feces supports a diverse microbial community, including various actinomycete species that thrive in such organic-rich substrates [10]. Actinomycetes in fecal environments play a vital role in decomposing organic matter and cycling nutrients, thereby enhancing their metabolic capabilities [11]. The presence of these microorganisms in feces can lead to the production of bioactive compounds, including antibiotics, which are beneficial for ecological balance and potential pharmaceutical applications [12]. Additionally, the interaction between actinomycetes and other microbial communities in feces can further enrich their metabolic profiles, making fecal matter a valuable resource for discovering novel actinomycete strains with unique properties [13].
The microbiota of sheep feces, including actinomycetes, significantly contributes to organic matter decomposition and nutrient cycling. Actinomycetesare key players in breaking down complex organic materials, such as cellulose and lignin, facilitating the conversion of organic waste into simpler compounds that plants and other microorganisms can utilize [14 ,15]. During the composting process, actinomycetes, bacteria, and fungi function as chemical decomposers, transforming organic matter into stable products like compost, which enriches soil fertility [16]. Their metabolic activities enhance nutrient availability and contribute to forming soil aggregates, improving soil structure and health [17]. Overall, the presence of actinomycetes in sheep feces highlights their ecological importance in maintaining soil health and promoting sustainable agricultural practices through effective nutrient recycling [18].
Polyketide synthases (PKS) and non-ribosomal peptide synthetases (NRPS) are essential enzymes involved in the biosynthesis of secondary metabolites, encompassing a wide range of bioactive compounds. PKS and NRPS are characterized by their modular organization, where each module incorporates specific substrates into the final product. This modularity enables the synthesis of structurally diverse compounds through the assembly of various building blocks [19]. Typically, these enzymes are organized in biosynthetic gene clusters (BGCs), facilitating the coordinated expression of the genes required for synthesizing these complex molecules. The arrangement of genes within these clusters can vary significantly, with some clusters containing hybrid PKS/NRPS systems that combine functionalities of both types of synthases [20]. This organization enhances biosynthesis efficiency and allows for the evolution of new compounds through gene rearrangements and modifications [21].
This study focused on the isolation and characterization of actinomycetes from sheep feces, assessing their antibacterial potential and screening for PKS and NRPS genes. Actinomycetes are known for their ability to produce a variety of bioactive secondary metabolites, making them valuable for biotechnological applications, particularly in antibiotic discovery [22]. Research has demonstrated that Actinomycetesisolated from various environments, including fecal matter, can exhibit significant antimicrobial activity. For example, studies have reported that a substantial percentage of isolated Actinomycetes possess PKS and NRPS genes, indicating their potential for producing secondary metabolites with antibacterial properties [23]. The presence of these BGCs is crucial for developing new antibiotics, especially in light of rising antibiotic resistance [24]. Thus, this study aimed to isolate Actinomycetes from sheep feces and investigate their potential for producing novel antimicrobial compounds, with a focus on the presence of BGCs such as PKS and NRPS, which are critical for the development of new antibiotics in response to increasing antibiotic resistance.
Results
Isolation and Identification of Actinomycetes
Eighty-six Actinomycetes isolates were obtained from sheep feces. These isolates exhibited diverse colony morphologies, including variations in texture and pigmentation. All isolates were Gram-positive and filamentous, characteristic of Actinomycetes. The identity of all isolates was confirmed through PCR amplification of the 16S rRNA gene, resulting in a product of approximately 640 base pairs (Figure 1).

Figure1.Agarose gel electrophoresis of 16S rRNA PCR products from bacterial isolates Lane M: DNA size marker; Lane 1: Negative control; Lanes 2–15: PCR products from bacterial isolates showing a 640 bp band representing the amplified 16S rRNA gene.
Antibacterial Activity
Out of 86 tested isolates, 17 strains showed antibacterial activity against one or more pathogens. The activity distribution was as follows: against Staphylococcus aureus: 16.1% (1 isolate), against Escherichia coli: 65.4% (4 isolates), against Pseudomonas aeruginosa: 32.2% (2 isolates), and against Bacillus cereus: 62.1% (10 isolates). The most potent activity was observed against Bacillus cereus, underscoring the therapeutic potential of these isolates.
Molecular Identification and Gene Screening
PCR analysis revealed the following distribution of biosynthetic genes: 31 isolates (36.04%) carried NRPS, 15 isolates (17.44%) harbored PKS-I, and 16 isolates (18.6%) contained PKS-II genes (Figures 2-4). These findings indicate substantial biosynthetic potential among the isolates for secondary metabolite production.

Figure2.Agarose gel electrophoresis of NRPS gene PCR products from actinomycete isolates Lane M: DNA size marker; Lane 1: Negative control; Lanes 2–15: PCR products from actinomycete isolates, displaying bands between 700–750 bp, indicative of the amplified NRPS gene.

Figure3.Agarose gel electrophoresis of PKS-I gene PCR products from actinomycete isolates Lane M: DNA size marker; Lane 1: Negative control; Lanes 2–15: PCR products from actinomycete isolates showing a band at 1200-1400 bp, representing the amplified PKS-I gene.

Figure4.Agarose gel electrophoresis of PKS-II gene PCR products from actinomycete isolates Lane M: DNA size marker; Lane 1: Negative control; Lanes: 2–15: PCR products from actinomycete isolates exhibiting a band at approximately 600 bp, corresponding to the amplified PKS-II gene.
Discussion
The study of Actinomycetesisolated from sheep feces has unveiled their potential as a source of antibacterial compounds, which is particularly relevant in the context of rising antibiotic resistance. Actinomycetes are renowned for their ability to produce bioactive metabolites that can effectively combat both Gram-positive and Gram-negative bacteria, including notorious pathogens such as B. cereus and E. coli.
Actinomycetes are recognized for their production of secondary metabolites with antimicrobial properties, making them important candidates in the search for new antibiotics [25,26]. The successful isolation of 86 Actinomycetesstrains, with 17 exhibiting notable antibacterial activity, underscores the ecological richness of this niche and the potential for discovering novel antibacterial agents [27]. Previous studies have demonstrated that various Actinomycetes strains produce metabolites that inhibit the growth of critical pathogens, suggesting their valuable role in developing new antibiotics, particularly against resistant strains [28].
The microbiota present in sheep feces, particularly enriched with Actinomycetes, plays a crucial role in organic matter decomposition and nutrient cycling, which enhances soil fertility [16]. Actinomycetes facilitate the breakdown of complex organic materials, contributing to soil organic matter (SOM) and nutrient availability [29,30]. The diversity ofActinomycetesisolated from various habitats, including extreme environments, indicates unique antibacterial activities [31,32]. This ecological significance supports the notion that environments rich in Actinomycetes serve as reservoirs for microorganisms capable of producing bioactive compounds with applications in agriculture and medicine [33 ].
Molecular characterization of isolates has revealed their potential as producers of bioactive compounds. Research indicates that a significant percentage of isolates possess genes associated with secondary metabolite production, highlighting their capacity for synthesizing antimicrobial compounds [34]. The presence of PKS and NRPS genes further suggests a robust biosynthetic machinery capable of generating diverse secondary metabolites [20]. Notably, the discovery of hybrid PKS systems has led to the identification of novel aromatic polyketides with therapeutic applications [35 ].
The antibacterial activity of isolated Actinomycetes against B. cereus has important implications for food safety and industrial contamination management. For instance, certain strains have shown potential as biocontrol agents in the food industry, effectively inhibiting the growth of B. cereus and downregulating its toxin-related genes [36]. Similarly, natural compounds, such as olive oil polyphenol extract, have demonstrated efficacy in reducing B. cereus populations in dairy products [37]. The inhibition of E. colialso holds significant implications in both veterinary and medical fields, with advancements in monoclonal antibodies and novel small-molecule inhibitors showing promise as alternatives to traditional antibiotics [38,39 ].
Future research should prioritize the purification and characterization of bioactive compounds exhibiting antibacterial effects. Techniques such as metabolomic profiling and bioassay-guided fractionation are essential for elucidating the chemical structures and mechanisms of action of these metabolites [40,41]. Additionally, exploring the regulatory pathways governing the expression of PKS and NRPS genes is crucial for optimizing metabolite yield and diversity [42,43]. The study of unconventional habitats like sheep feces for microbial bioprospecting is gaining traction, revealing diverse microbial communities with potential applications in agriculture and biotechnology [44,45 ].
In conclusion, combining molecular and microbiological approaches is vital for developing novel antimicrobial agents to combat emerging drug-resistant pathogens. Innovative strategies, including the use of antimicrobial peptides, nanoparticles, and new classes of antibiotics, represent significant advancements in addressing the urgent challenge of antibiotic resistance [46 ,47, 48]. The exploration of natural antibacterial agents from sources like Actinomycetesnot only enhances food safety but also contributes to sustainable practices in veterinary pharmacology and agriculture.
Materials And Methods
Sample Collection
Fresh sheep feces samples were collected from 28 sheep grazing in various geographical regions of Ilam Province, Iran, between March and June 2021.
Sample Preparation and Enrichment
Fresh sheep feces were aseptically collected using sterile forceps. The sample was immediately placed in a sterile zipped bag and transported to the laboratory on ice within two hours of collection.
In the laboratory, each sheep feces sample was thoroughly mixed, and 1 gram of the homogenized sample was serially diluted in sterile distilled water (10-fold dilutions up to 10^-6^). A volume of 100 μL from each dilution was spread-plated onto two different media: nutrient agar (NA) is a general-purpose medium used for the growth of a wide variety of microorganisms, while starch casein agar (SCA) is a selective medium that enhances the growth of actinobacteria by incorporating starch and casein as sources of carbon and nitrogen.
To inhibit the growth of fungi and other bacteria, both media were supplemented with 50 μg/mL and 50 μg/mL of cycloheximide and nalidixic acid, respectively.
Isolation and Purification of Actinomycetes
The inoculated plates were incubated at 28°C for 7-14 days. Distinct colony morphologies were observed and selected for further purification. Single colonies were subcultured onto NA and SCA plates until pure isolates were obtained.
Morphological Characterization of Actinomycetes
Isolate identification was based on morphological traits, including colony size, shape, color, margin, elevation; microscopic features such as Gram stain reaction, mycelium formation, and spore morphology; and pigmentation, which may be diffusible or non-diffusible.
DNA Extraction and Molecular Identification of Actinomycetes
Genomic DNA was extracted from pure cultures using a modified method based on Peng et al. (2013) [49]. Briefly, 2 mL of a 48-hour culture grown in TSB at 37°C was centrifuged at 6,000 g for 2 minutes. The supernatant was discarded, and the pellet was resuspended in 300 μL of lysis buffer (50 mM Tris-HCl, pH 8.0; 100 mM EDTA; 100 mM NaCl). This suspension was incubated at 55°C for 60 minutes with gentle shaking, followed by centrifugation at 16,000 g for 5 minutes. The supernatant containing the DNA was transferred to a new tube and stored at -20°C for further analysis. Polymerase chain reaction (PCR) targeting the 16S rRNA gene was performed using Actinomycetes-specific primers, as listed in Table 1 and described previously [50].
Detection of BGCs
Using specific primers listed in Table 1, the presence of PKS-I, PKS-IIand NRPS genes was investigated by PCR as described elsewhere [51,52].
Antibacterial Activity Assay
All actinomycetal isolates were fermented, and their resulting extracts were screened according to previous research without modifications [53].
| Primer name | Sequence (5’-3’) | Gene | Product size (bp) | Reference |
| ACT235f | CGCGGCCTATCAGCTTGTTG | 16S rRNA | 640 | 50 |
| ACT878r | CCGTACTCCCCAGGCGGGG | |||
| A3F | GCSTACSYSATSTACACSTCSGG | NRPS | 700-800 | 52 |
| A7R | SASGTCVCCSGTSCGGTAS | |||
| KIF | TSAAGTCSAACATCGGBCA | PKS-I | 1200-1400 | 51 |
| M6R | CGCAGGTTSCSGTACCAGTA | |||
| PKS-II-A | TSGCSTGCTTCGAYGCSATC | PKS-II | 600 | 52 |
| PKS-II-B | TGGAANCCGCCGAABCCGCT |
The antibacterial activity of the actinomycetal strains was evaluated using reference strains of two Gram-negative and two Gram-positive pathogens (Table 2). The bacteria were cultured overnight at 37ºC in Mueller-Hinton (MH) broth, and the culture was then adjusted to a turbidity level of 0.5 McFarland standard.
Following the procedure described by Hajizadeh et al. (2023) [53], bacterial lawns were created on MH agar with 6 mm wells, into which 100 μL of crude extracts were added. The plates were left at room temperature for one hour before being incubated at 37ºC. After 24 hours, the inhibition zones were assessed in millimeters (mm), utilizing 100.
| Reference strain | Accession number |
| Bacillus cereus | PTCC 1015 |
| Escherichia coli | PTCC 1330 |
| Pseudomonas aeruginosa | PTCC 1430 |
| Staphylococcus aureus | ATCC 33591 |
Authors' Contributions
T.M., F.P., and G.H. conceived and planned the experiments. T.M. and F.P. carried out the experiments. T.M, and F.P. contributed to sample preparation. T.M., F.P., and K.S. contributed to the interpretation of the results. F.P. took the lead in writing the manuscript. All authors provided critical feedback and helped shape the research, analysis and manuscript.
Acknowledgements
The authors express gratitude to the Vice Chancellor for Research and Technology at Ilam University, Ilam, Iran, for their partial financial support of this study.
Conflict of interest
The authors declare that there is no conflict of interest.
Abbreviations - cont'd
TSB: Tryptic Soy Broth
EDTA: Ethylenediaminetetraacetic Acid
SOM: Soil Organic Matter
MH: Mueller-Hinton
bp: Base Pairs
RNA: Ribosomal RNA
SOM: Soil Organic Matter;
B. cereus: Bacillus cereus
E. coli: Escherichia coli
S. aureus: Staphylococcus aureus
P. aeruginosa : Pseudomonas aeruginosa
References
- Chaudhary HS, Soni B, Shrivastava AR, Shrivastava S. Diversity and versatility of actinomycetes and its role in antibiotic production. J Appl Pharm Sci. 2013;3(8):83-94.DOI
- Lacey HJ, Rutledge PJ. Recently discovered secondary metabolites from Streptomyces species. Molecules. 2022;27(1):1-16..DOI
- Singh V, Haque S, Singh H, Verma J, Vibha K, Singh R, Jawed A, Tripathi CK. Isolation, screening, and identification of novel isolates of actinomycetes from India for antimicrobial applications. Front Microbiol. 2016;6(7):1921.DOI
- Selim MSM, Abdelhamid SA, Mohamed SS. Secondary metabolites and biodiversity of actinomycetes. J Genet Eng Biotechnol. 2021;19(1):72.DOI
- Trenozhnikova LP, Baimakhanova GB, Baimakhanova BB, Balgimbayeva AS, Daugaliyeva ST, Faizulina ER, et al. Beyond traditional screening: Unveiling antibiotic potentials of actinomycetes in extreme environments. Heliyon. 2024;10(1):1-16.DOI
- Kaale SE, Machangu RS, Lyimo TJ. Molecular characterization and phylogenetic diversity of Actinomycetota species isolated from Lake Natron sediments at Arusha, Tanzania. Microbiol Res. 2024;278:127543.DOI
- Shrestha B, Nath DK, Maharjan A, Poudel A, Pradhan RN, Aryal S. Isolation and Characterization of Potential Antibiotic‐ P roducing Actinomycetes from W ater and S oil S ediments of Different Regions of Nepal. International J Microbiol. 2021;2021(1):5586165.DOI
- Behie SW, Bonet B, Zacharia VM, McClung DJ, Traxler MF. Molecules to ecosystems: Actinomycete natural products in situ. Front Microbiol. 2017;7:1-11.DOI
- Masand M, Jose PA, Menghani E, Jebakumar SR. Continuing hunt for endophytic actinomycetes as a source of novel biologically active metabolites. World Journal of Microbiol Biotech. 2015;31:1863-75.DOI
- Hayashida S, Nanri N, Teramoto Y, Nishimoto T, Ohta K, Miyaguchi M. Identification and characteristics of actinomycetes useful for semicontinuous treatment of domestic animal feces. Appl Environ Microbiol. 1988;54(8):2058-2063.DOI
- Dentzien-Dias P, Poinar G, Francischini H. A new actinomycete from a Guadalupian vertebrate coprolite from Brazil. Hist Biol. 2017;29(6):770-776..DOI
- Lee HW, Ahn JH, Kim M, Weon HY, Song J, Lee SJ, et al. Diversity and antimicrobial activity of actinomycetes from fecal sample of rhinoceros beetle larvae. Korean J Microbiol. 2013;49(2):156-164.DOI
- Wang X, Zhang Z, Wang X, Bao Q, Wang R, Duan Z. The impact of host genotype, intestinal sites and probiotics supplementation on the gut microbiota composition and diversity in sheep. Biology. 2021;10(1):1-16..DOI
- Ahmad A, Sur S. Biodegradable solid waste management by microorganism: challenge and potential for composting. Int J Recycl Org Waste Agric. 2023;12(1):735-745.DOI
- Game BC, Deokar CD, Jadhav AC. Characterization of cellulolytic microorganisms associated with naturally decomposing waste material. Int J Curr Microbiol App Sci. 2018;7(1):1710-1719.DOI
- Sánchez ÓJ, Ospina DA, Montoya S. Compost supplementation with nutrients and microorganisms in composting process. Waste Manag. 2017;69:136-153.DOI
- Forster SM. The role of microorganisms in aggregate formation and soil stabilization: Types of aggregation. Arid Land Res Manage. 1990;4(1):85-98.DOI
- Abdelrahman OY, Yagi S, El Siddig M, El Hussein A, Germanier F, De Vrieze M, et al. Evaluating the antagonistic potential of actinomycete strains isolated from Sudan's soils against Phytophthora infestans. Front Microbiol. 2022;13:1-13.DOI
- Hwang S, Lee N, Cho S, Palsson B, Cho BK. Repurposing modular polyketide synthases and non-ribosomal peptide synthetases for novel chemical biosynthesis. Front Mol Biosci. 2020;7:1-27.DOI
- Wang H, Fewer DP, Holm L, Rouhiainen L, Sivonen K. Atlas of nonribosomal peptide and polyketide biosynthetic pathways reveals common occurrence of nonmodular enzymes. Proc Natl Acad Sci. 2014;111(25):9259-9264.DOI
- Quadri LE. Assembly of aryl‐capped siderophores by modular peptide synthetases and polyketide synthases. Mol Microbiol. 2000;37(1):1-12.DOI
- Lee LH, Zainal N, Azman AS, Eng SK, Goh BH, Yin WF, et al. Diversity and antimicrobial activities of actinobacteria isolated from tropical mangrove sediments in Malaysia. Sci World J. 2014;2014:1-16.DOI
- Tatar D. Isolation, phylogenetic analysis and antimicrobial activity of halophilic actinomycetes from different saline environments located near Çorum province. Biologia. 2021;76(5):773-780.DOI
- Okada BK, Seyedsayamdost MR. Antibiotic dialogues: Induction of silent biosynthetic gene clusters by exogenous small molecules. FEMS Microbiol Rev. 2017;41(1):19-33.DOI
- Lima SMA, Pereira PS, da Silva BIM, Ribeiro NE, de Oliveira Borba EF, Tintino CDDM, et al. Antioxidant, antimicrobial and cytotoxic activities of secondary metabolites from Streptomyces sp. isolated of the Amazon-Brazil region. Res Soc Dev. 2021;10(1):e366101018974.DOI
- Shikuku BO, Kiruki S, Kuria E, Mutembei M, Ogolla FO. Characterization of antibiotic-producing actinomycetes isolated from River Tana and Lake Elementaita in Kenya. Asian J Res Biochem. 2023;13(1):26-41..DOI
- Bandara N, Tmiuk T. Isolation and identification of actinomycetes with antibacterial activity from soil samples around Kandy, Sri Lanka. Curr Res Pharm Sci. 2023;13(1):118-125.DOI
- Setiawati S, Nuryastuti T, Sholikhah EN, Lisdiyanti P, Pratiwi SUT, Sulistiyani TR, et al. The potency of actinomycetes extracts isolated from Pramuka Island, Jakarta, Indonesia as antimicrobial agents. Biodiver J Biol Divers. 2021;22(1):1104-1111.DOI
- Brendecke JW, Axelson RD, Pepper IL. Soil microbial activity as an indicator of soil fertility: long-term effects of municipal sewage sludge on an arid soil. Soil Biol Biochem. 1993;25(6):751-758.DOI
- Ghosh S, Tripathi SK. Microbial succession and changes in carbon and nitrogen during decomposition of leaf litters of Tephrosia candida (Roxb.) DC. and Oryza sativa L. under shifting cultivation in Mizoram, northeast India. J Appl Nat Sci. 2021;13(1):1032-1040.DOI
- Kumar V, Bisht GS, Gusain O. Terrestrial actinomycetes from diverse locations of Uttarakhnad, India: Isolation and screening for their antibacterial activity. Iranian J Microbiol. 2013;5(4):299-308.
- Paul S, Paul S, Tisad ZM. Antimicrobial potentialities of Streptomyces species isolated from mangrove soil samples of Sundarbans. Methodology. 2020;5(1):295-330.
- Rozirwan RO, Muda HI, Ulqodry TZ. Antibacterial potential of Actinomycetes isolated from mangrove sediment in Tanjung Api-Api, South Sumatra, Indonesia. Biodivers J Biol Divers. 2020;21(1):1-14.DOI
- Graça AP, Calisto R, Lage OM. Planctomycetes as novel source of bioactive molecules. Front Microbiol. 2016;7:1-16.DOI
- Zhao LY, Shi J, Xu ZY, Sun JL, Yan ZY, Tong ZW, et al. Hybrid type I and II polyketide synthases yield distinct aromatic polyketides. J Am Chem Soc. 2024;146(1):29462-29468.DOI
- Eom JS, Lee SY, Choi HS. Bacillus subtilis HJ18‐4 from traditional fermented soybean food inhibits Bacillus cereus growth and toxin‐related genes. J Food Sci. 2014;79(11):2279-2287.DOI
- Fei P, Xu Y, Zhao S, Gong S, Guo L. Olive oil polyphenol extract inhibits vegetative cells of Bacillus cereus isolated from raw milk. J Dairy Sci. 2019;102(5):3894-3902.DOI
- Tian Y, Lu S, Zhou S, Li Z, Guan S, Chen H, et al. Screening of neutralizing antibodies against FaeG protein of Enterotoxigenic Escherichia coli . Vet Sci. 2024;11(1):1-14.DOI
- Hanson BS, Hailemariam A, Yang Y, Mohamed F, Donati GL, Baker D, et al. Identification of a copper-responsive small molecule inhibitor of uropathogenic Escherichia coli. J Bacteriol. 2024;206(1):12-24.DOI
- Kellogg JJ, Todd DA, Egan JM, Raja HA, Oberlies NH, Kvalheim OM, et al. Biochemometrics for natural products research: comparison of data analysis approaches and application to identification of bioactive compounds. J Nat Prod. 2016;79(2):376-386.DOI
- Quitério EG, Grosso C, Ferraz R, Delerue-Matos C, Soares C. A critical comparison of the advanced extraction techniques applied to obtain health-promoting compounds from seaweeds. Mar Drugs. 2022;20(1):1-40.DOI
- Bergmann S, Funk AN, Scherlach K, Schroeckh V, Shelest E, Horn U, et al. Activation of a silent fungal polyketide biosynthesis pathway through regulatory cross talk with a cryptic nonribosomal peptide synthetase gene cluster. Appl Environ Microbiol. 2010;76(24):8143-8149.DOI
- Wasil Z, Pahirulzaman KA, Butts C, Simpson TJ, Lazarus CM, Cox RJ. One pathway, many compounds: heterologous expression of a fungal biosynthetic pathway reveals its intrinsic potential for diversity. Chem Sci. 2013;4(10):3845-3856.DOI
- Aisy ND, Wardani ARD, Paradhipta DHV, Agus A, Noviadi CT. Chemical composition and fermentation characteristics of different proportions of fermented poultry manure and sheep feces as unconventional feed. J Ilmu-Ilmu Peternakan. 2024;34(1):51-59.DOI
- Wang J, Fan H, Han Y, Zhao J, Zhou Z. Characterization of the microbial communities along the gastrointestinal tract of sheep by 454 pyrosequencing analysis. Asian-Australas J Anim Sci. 2017;30(1):100-110..DOI
- Choi JJ, McCarthy MW. Cefiderocol: a novel siderophore cephalosporin. Expert Opin Investig Drugs. 2018;27(2):193-197..DOI
- Rajchakit U, Sarojini V. Recent developments in antimicrobial-peptide-conjugated gold nanoparticles. Bioconjugate Chem. 2017;28(11):2673-2686..DOI
- Waller AS, Clements JM. Novel approaches to antimicrobial therapy: peptide deformylase. Curr Opin Drug Discov Dev. 2002;5(6):785-792.
- Peng X, Yu KQ, Deng GH, Jiang YX, Wang Y, Zhang GX, et al. Comparison of direct boiling method with commercial kits for extracting fecal microbiome DNA by Illumina sequencing of 16S rRNA tags. J Microbiol Methods. 2013;95(3):455-462.DOI
- Stach JE, Maldonado LA, Ward AC, Goodfellow M, Bull AT. New primers for the class Actinobacteria : Application to marine and terrestrial environments. Environ Microbiol. 2003;5(10):828-841..DOI
- Ayuso-Sacido A, Genilloud O. New PCR primers for the screening of NRPS and PKS-I systems in actinomycetes: Detection and distribution of these biosynthetic gene sequences in major taxonomic groups. Microb Ecol. 2005;49(1):10-24.DOI
- Metsä-Ketelä M, Salo V, Halo L, Hautala A, Hakala J, Mäntsälä P, et al. An efficient approach for screening minimal PKS genes from Streptomyces . FEMS Microbiol Lett. 1999;180(1):1-6.DOI
- Hajizadeh M, Pourahmad F, Nemati M. Isolation and screening of antibacterial activity of Actinomycetota from the medicinal plant, Anthemis pseudocotula Boiss. Arch Razi Inst. 2023;78(1):1638-1646.DOI