Abbreviations
PCR: Polymerase Chain Reaction,
MDR: Multi-Drug Resistant
CLSI: Clinical and Laboratory Standard Institute
MBL: Metalo Beta-Lactamase
ESBL: Extended Spectrum Beta-Lactamase
ATCC: American Type Culture Collection, IMP:
Introduction
The occurrence and expansion of antimicrobial resistance have turned into a major threat to the healthcare of human beings, animals, and the environment worldwide [ 1 , 2 ]. Having direct or indirect contact with affected animals and contaminated environments can speed up the easy transfer of microorganisms between humans and animals [ 3 ]. Therefore, monitoring antimicrobial resistance in animal-originated bacteria, and finding enough data about the paths of the spread of antimicrobial resistance and associated genes and their transfer between different elements of the ecosystem is extremely important [ 4 ]. Nevertheless, despite the significant amount of information examining antimicrobial resistance in food-producing animals, a small number of studies have evaluated antimicrobial resistance in bacteria originating from equine [ 5 ]. Due to the recurrent use of identical antibiotics for curing human beings and horses, equine-origin antibiotic-resistant microorganisms not only affect their health and limit treatment options, but also endanger the health of people in contact with these animals [ 4 , 6 , 7 ]. E. coli is a predominant commensal microorganism that is found in the gastrointestinal microflora of human beings and animals. In comparison with other common bacteria, E. coli can easily gain antimicrobial resistance via genetic mutation or horizontal gene transfer through a variety of mobile genetic elements, such as self-transmissible plasmids, transposons, and integrons [ 8 ]. These mobile genetic elements may co-carry multi-antimicrobial resistance genes, including ESBL, aminoglycosides, sulfa-derivatives, trimethoprim, and quinolone resistance [ 9 ]. During the co-colonization of antibiotic-resistant bacteria along with non-resistant bacteria, resistance genes can quickly spread and exchange between bacterial isolates and may facilitate the appearance of MDR bacteria [ 8 , 10 ].
One may find a considerable genetic substructure in E. coli species, which has been adopted as an easy and cheap method to assign an E. coli isolate to a phylogroup [ 11 ]. According to the revised Clermont PCR method for phylotyping Escherichia coli, the strains of E. coli species could be categorized as eight phylogenetic groups (A, B1, B2, C, D, F, and cryptic clade I) based on the presence or absence of chuA (a gene required for heme transport), yjaA (a gene having unknown performance), arpA, and trpA genes as well as the DNA fragment TspE4. C2 is identified as a putative lipase/esterase gene [ 12 ]. It was realized that phylogroup strains are different in terms of phenotypic and genotypic features, ecological niche, traits of life history, and capability to create a disease. For example, virulent extra-intestinal strains are the major members of group B2 and, to a lesser degree, group D, while the majority of commensal strains belong to group A or B1 and strains belonging to phylogroup F are more likely to be implicated as the extra-intestinal pathogens of companion animals, horses, cattle, and humans [ 11 , 12 ].
There is limited data about antimicrobial resistance and phylogroup distribution in the equine population in northern Iran. E. coli is occasionally adopted as a sentinel strain for examining antimicrobial resistance in fecal bacteria [ 13 ]. Therefore, the present study was conducted to determine the antimicrobial resistance patterns, biofilm-forming ability, and distribution of resistance and biofilm-associated genes in different phylogroups of fecal E. coli isolates in healthy horses in Guilan province, north of Iran.
Results
Bacterial Isolates and Phylogenetic Typing
In this study, a total of 157 E. coli strains were isolated. Analysis of PCR results for determining phylogenetic groups among these isolates showed that phylogenetic groups B1 (46.50%) and A (21.66%) were the most common followed by C (6.37%), clade I (5.10%), E (4.46%), D (3.82%), and B2 (2.55%). In 9.55% of isolates, the phylogenetic group was unknown.
Antimicrobial Susceptibility Testing
We observed that 26 isolates were sensitive to all 16 antibiotics used in the assay and 131 isolates (83.4%) were resistant to at least one antibiotic. More than 50% of isolates (83 isolates) showed MDR phenotype (resistant to three classes of antibiotics), three horses (1.9%) were colonized by ESBL-positive isolates, and one isolate (0.63%) indicated an imipenem-resistant phenotype.
The outcomes of testing the antibacterial susceptibility of E. coli isolates to common antibiotics have been shown in Table 1 and Figure 1. Overall, 85 diverse patterns of antibiotic resistance have been found in 157 isolates (Supplementary data). The most considerable level of resistance was observed for streptomycin (59.87%) followed by trimethoprim-sulfamethoxazole (29.93%) and oxytetracycline (28.66%). Imipenem and norfloxacin were the most potent antibiotics. All isolates belonging to phylogenetic groups B2, D, and E were MDR. The other MDR isolates were in the phylogroups A (20/34), B1 (39/73), C (4/10), and unknown (3/15).
| Antibiotic | Resistant isolates | Intermediate isolates | Sensetive isolates |
|---|---|---|---|
| Amikacin | 12 (7.64%) | 6 (3.82%) | 139 (88.53%) |
| Gentamycin | 1 (0.63%) | 6 (3.82%) | 150 (95.5%) |
| Imipeneme | 1 (0.63%) | 1 (0.63%) | 155 (98.72%) |
| Ceftazidime | 25 (15.92%) | 1 (0.63%) | 131 (83.43%) |
| Cefotaxime | 9 (5.73%) | 1 (0.63%) | 147 (93.63%) |
| Ampicillin | 32 (20.83%) | 4 (2.54%) | 121 (77.07%) |
| Amoxi-Clav | 27 (17.19%) | 1 (0.63%) | 129 (82.16%) |
| Aztronam | 29 (18.47%) | 0 (0%) | 128 (81.52%) |
| Chloramphenocol | 19 (12.10%) | 4 (2.52%) | 134 (85.35%) |
| Ciprofloxacin | 2 (1.27%) | 2 (1.27%) | 153 (97.45%) |
| Nalidixic acid | 24 (15.28%) | 3 (1.91%) | 130 (82.80%) |
| Trimethoprim-Sulfamethoxazol | 47 (29.93%) | 1 (0.63%) | 109 (69.42%) |
| Doxycycline | 32 (20.38%) | 12 (7.64%) | 113 (71.97%) |
| Oxytetraycline | 45 (28.66%) | 0 (0%) | 112 (71.33%) |
| Streptomycin | 94 (59.87%) | 12 (7.64%) | 51 (32.48%) |
| Norfloxacin | 2 (1.27%) | 0 (0%) | 155 (98.72%) |

Figure 1. Antibacterial susceptibility testing of E. coli isolates
Biofilm-Forming Assay
Of 157 evaluated isolates, 81 (51.6%) were positive in terms of biofilm-forming ability. All MDR isolates were capable of forming a biofilm. The frequency of biofilm-related genes fimH, papC, csgA, and fliC in biofilm former E. coli isolates was 100%, 100%, 77.77%, and 65.43%, respectively. In addition, resistance to all examined antibiotics in biofilm-former strains was higher than biofilm-negative ones (data not shown).
Dissemination of Biofilm-Related Genes in Various Phylogroups
Dissemination of different phylogenetic groups in biofilm-former and biofilm-non-former strains of E. coli is presented in Table 2 and Figure 2. All isolates in phylogroups B2 and D carried all biofilm-related genes. More than half of the isolates in the E and A phylogroups were biofilm-formers and carried variable biofilm-related genes. The allocation of biofilm-related genes in various phylogroups is presented in Supplementary Table 2. There was no significant association between different phylogroups and bio film-forming ability among test bacteria (p < 0.05).
| Phylo-group | No. of isolates | |
|---|---|---|
| Biofilm positive | Biofilm negative | |
| A, (34) | 18 | 16 |
| B1, (73) | 34 | 39 |
| B2, (4) | 4 | - |
| C, (10) | 6 | 4 |
| D, (6) | 6 | - |
| E, (7) | 5 | 2 |
| clade I, (8) | 3 | 5 |
| Unknown, (15) | 6 | 9 |

Figure 2. Distribution of different phylogenetic group in biofilm former and biofilm non former E. coli strains
PCR Screening for Antimicrobial Resistance Genes
Streptomycin resistance-associated genes were more common in test isolates, followed by tet and dfr1 genes as the most frequent ones. The blaTEM and/or blaSHV genes were detected in three ESBL-positive isolates. Most of the resistance genes were more frequent in biofilm-forming isolates (p < 0.05). Antimicrobial resistance genes were common in phylogroups B2, D, A, B1, and E (p < 0.05). Each isolate in phylogroups B2 and D carried at least three investigated drug-resistance genes. The distribution of antimicrobial resistance genes in biofilm-former, biofilm-non-former, and different phylogroups of E. coli isolates is shown in Table 3.
| Gene (No.) | Biofilm formation | Phylo-group | |
|---|---|---|---|
| Positive, (81) | Negative, (76) | ||
| TEM, (2) | 3 (100%) | - | B2 (2), D (1) |
| SHV, (1) | 2 (100%) | - | B2 (1) |
| qnr A, (0) | - | - | - |
| qnr B, (3) | 3 (100%) | - | B1 (1), B2 (2) |
| tetA, (39) | 28 (71.79) | 11 (28.21) | A (12), B1 (16), B2 (4), D (4), E (3) |
| tetB, (48) | 42 (87.5%) | 6 (12.5%) | A (14), B1 (17), B2 (4), D (5), C (2), E (5), clade I (1) |
| strA-strB, (54) | 42 (77.77) | 12 (33.33) | A (19), B1 (23), B2 (3), C (2), D (4), E (1), unknown (2) |
| aadA, (5) | 5 (100%) | - | B2 (3), D (2) |
| aadB, (8) | 8 (100%) | - | B1 (2), B2 (3), D (2), E (1) |
| Cat I, (11) | 8 (72.72) | 3 (27.28) | A (2), B1 (1), B2 (4), D (2), E (1), unknown (1) |
| Cat II, (7) | 5 (71.42) | 2 (27.58) | A (1), B2 (3), D (2), E (1) |
| Sul 1, (23) | 21 (91.3) | 2 (8.7) | A (4), B1 (7), B2 (3), D (4), E (2), Clade I (2), un-known (1) |
| Sul 2, (17) | 17 (100%) | - | A (3), B1 (5), B2 (3), D (2), E (1), Clade I (2), un-known (1) |
| Dfr1, (36) | 26 (72.22) | 10 (27.28) | A (7), B1 (12), B2 (4), C (2), D (5), E (5), unknown (1) |
Discussion
Commensal E. coli resistance is of special importance to maintaining consumer health as it includes a source of resistance genes. This resistance can be transferred to any other bacteria, such as pathogenic bacteria, through horizontal gene transfer [ 9 , 14 ]. Veterinary healthcare settings in recent decades have been introduced as the origin of the outbreaks of different multidrug-resistant microorganisms [ 10 , 15 , 16 ]. Injection of antimicrobial agents into horses in both hospital and community contexts is accompanied by a higher risk of the fecal shedding of antimicrobial-resistant E. coli [ 5 ]. In this study, 85 diverse patterns of antibiotic resistance were detected in 157 isolates, and 131 isolates (83.4%) were resistant to at least one antibiotic. Of 157 E. coli isolates examined in terms of antibiotic sensitivity, more than 50% (83 isolates) showed MDR phenotype. Compared to other studies, frequency of MDR in equine fecal E. coli was high in the present study. However, our results were comparable with that of Lagarde et al. (2019), which reported 46.3% MDR in E. coli isolated from healthy horses [ 17 ]. A high level of AMR in domesticated animals is related to the use of antimicrobial agents and is also related to direct exposure to the bacteria responsible for carrying these genes [ 18 ].
In the present study, three ESBL-producing isolates harboring blaTEM (three isolates) and blaSHV (two isolates) genes were identified. Kaspar et al. (2019) detected 9 (4.0%) ESBL-producing E. coli positive in terms of blaCTX-M and/or blaTEM in non-hospitalized horses in Northwest Germany [ 10 ]. In another research conducted in the United Kingdom, 6.3% of 650 fecal samples from non-hospitalized horses were reported to be positive regarding ESBL-E. coli [ 19 ]. In Canada, ESBL/AmpC genes were found in E. coli obtained from 7.3% of healthy horses [ 17 ].
In a higher frequency, Johns et al. (2012) reported 138/228 (60.5%) MDR and 17/228 isolates positive for ESBL production in fecal E. coli isolates of horses treated with antimicrobial agents, among which 12/17 isolates had blaTEM gene and 4/17 had blaSHV [ 5 ]. Moreover, examinations of equine patients in a veterinary clinical context revealed even higher percentages (10.7% and 34.2%) of animals that carry ESBL [ 20 , 21 ]. These findings confirm previous descriptions based on which feces from hospitalized horses and horses cured with antibiotics harbored more antimicrobial-resistant E. coli isolates compared to untreated horses and are more likely to harbor MDR [ 22 , 23 ].
Present results showed the highest frequency was for streptomycin resistance (59.87%) and the most prevalent resistance gene (54/94) was related to this medication. This result is consistent with those obtained by Sato et al. (2020) indicating the highest (30.9%) streptomycin resistance among E. coli strains obtained from healthy racehorses in Japan. Furthermore, in accordance with the present results, they reported that almost all E. coli isolates have been susceptible to kanamycin and gentamycin (98.8% and 100%, respectively) [ 24 ]. In equine medicine, streptomycin is frequently used to cure gram-negative bacterial infections [ 8 ]. These can explain the high resistance rate of equine microbiota against this antibiotic. According to the phenotypic assay in this study, aadA and aadB were detected in five and eight aminoglycoside-resistant isolates, respectively, and strA-strB (streptomycin-resistance genes), as the most common resistant genes, were identified in 54 isolates.
In addition, possibly as a result of extensive application of trimethoprim-sulfamethoxazole to cure infections induced by gram-positive and gram-negative bacteria among horses [ 24 ], resistance to this antibacterial combination was relatively high in the tested isolates (47/157). However, in South Korea and Portugal, STX resistance was found to be 9.8% (5/51) and 2.8% (2/71), respectively [ 8 , 25 ]. In a study in Japan, 15.8% of E. coli isolates were found to be resistant to trimethoprim [ 24 ]. Among trimethoprim-sulfamethoxazol-resistant isolates, we detected dfr1, sul1, and sul2 in 76.6%, 48.9%, and 36.2%, respectively. Ahmed et al. (2010) reported that 93% of the trimethoprim-resistant equine fecal E. coli isolates were positive regarding at least one dfr gene [ 22 ]. These genes are often encod ed on mobile genetic elements, leading to this wide dissemination of dfr genes.
Among 19 chloramphenicol-resistant isolates identified in this study, catI and catII were detected in 11 and 7 isolates, respectively. catI gene was previously accountable for most of the plasmid-mediated resistance to chloramphenicol [ 22 ]. In addition, this article detected 51/157 isolates to be resistant to oxytetracycline and/or doxycycline, among which tetA and tetB genes were determined in 39 and 48 isolates, respectively. Tetracycline resistance in E. coli most often happens among animals, such as horses, and the efflux genes tetA and tetB are generally disseminated in gram-negative bacteria [ 22 , 26 ]. This pattern of prevalence was also shown in equine fecal E. coli strains from hospitalized horses in Northwest England in which the tetB gene showed to be the most common (71%) resistant to tetracycline, followed by tetA (18%), while no other tet gene was detected [ 17 ].
In the current study, 17.19% of E. coli isolates were not susceptible to the first generation of quinolones (nalidixic acid) but norfloxacin and ciprofloxacin were potent antibacterial agents (1.27% resistance). Compared to our results, Lagarde et al. reported that 54.1% of isolates from healthy horses were not susceptible to nalidixic acid, and 20.3% of isolates were not susceptible to ciprofloxacin, which is a fluoroquinolone in this collection [ 17 ].
Furthermore, the present assay detected biofilm-forming ability in 81/157 (51.6%) of fecal E. coli isolates. Resistance to every examined antibiotic in biofilm-former strains was significantly higher than in biofilm-negative antibiotics. The frequency of biofilm-associated genes fimH, papC, csgA, and fliC in biofilm-former E. coli isolates was 100%, 100%, 77.77%, and 65.43%, respectively. However, less data is available on biofilm formation and the distribution of its associated genes in microorganisms isolated from horses. In the USA, the prevalence of fimH and papC genes among 25 horse E. coli isolates was 92% and 4%, respectively [ 27 ]. Also, P fimbriae structural subunits-encoding genes, including papC, were the most commonly identified (75/164, 45.7%) virulence genes in E. coli from companion animals, including horses in the UK [ 28 ].
The present article also investigated the phylogenetic group of E. coli obtained from horses. In the present assay, commensal strains were predominant, and 68.2% of isolates were related to the phylogroups B1 and A. Among the remaining isolates, 10 (6.4%) were potential extraintestinal pathogens (B2 and D). In accordance with the present assay, in a study conducted in Iran, phylotype B1 was detected as the most common phylotype (76.92 %) among E. coli isolated from healthy riding horses in Kerman [ 29 ]. In the present study, every isolate in phylogroups B2 and D carried all biofilm-related genes. These findings are in line with the results of Olowe et al. (2019) who reported that phylogroups B2 and D contained 100% of each of the biofilm-related genes [ 30 ]. Biofilm-related genes fimH and papC were found in 100% of biofilm-positive isolates and were prevalent in all phylogroups. The fimH gene was determined to be common in every phylogroup of E. coli according to various studies [ 30 - 32 ].
Moreover, several studies have shown that phylogroups B2 and D have more biofilm-related gene characteristics compared to phylogroups B1 and A [ 30 , 33 - 35 ]. Our results showed that all isolates belonging to B2, D, and E phylogenetic groups were MDR. However, the isolates in the other phylogroups were also MDR, and several studies have shown that the strains of group B2 are mainly MDR [ 30 , 36 , 37 ].
Conclusion
Our findings demonstrated that in Guilan province, Northern Iran, non-hospitalized, healthy horses harbor potential extra-intestinal pathogenic and MDR E. coli isolates. These animals can be reservoirs for ESBL-producing and noteworthy human and veterinary medicine-used antibiotics-resistant isolates. The obtained data emphasized the growing concern regarding antimicrobial resistance, MDR shedding, and management of antimicrobial applications in veterinary.
Equine Study Population and Demographic Data
During May-August 2021, fresh feces samples were collected from 23 farms of 157 healthy and non-hospitalized horses that lived on private farms around Rasht, Northern Iran. The studied horses aged 3 months to 20 years, 72 were female, and 85 were male without receiving antibiotic therapy during the past six months.
E. coli Isolation and Antimicrobial Susceptibility Testing
Every single sample was transferred to the laboratory on the ice in 4 h. E. coli was isolated on MacConkey (MC) agar and EMB agar media and was evaluated based on standard bacteriology and biochemistry methods and one E. coli isolate was selected per sample for further investigation. The disk diffusion assay was adopted to determine the antimicrobial susceptibility pattern for each isolate of E. coli based on the Clinical and Laboratory Standards Institute suggestion [ 38 ].
The antimicrobials used in these assays were selected based on their use and importance for human and equine medicine as follow: beta-lactams , aminoglycosides , tetracyclines (oxytetracycline and doxycycline), sulphonamides/potentiated sulphonamides (sulphamethoxazole and trimethoprim-sulphamethoxazole), fluoroquinolones , carbapenems (imipenem), and chloramphenicol (C; 30µg), aztreonam (ATM; 30 µg). Plates were incubated at 37°C for 18-20 h. An isolate resistant to at least one antimicrobial agent in at least three antimicrobial classes was considered MDR. E. coli ATCC 25922 was included as quality control for the applied antimicrobial agents.
Extended-Spectrum Beta-Lactamase (ESBL) Production
ESBL production was detected by double disk diffusion technique with ceftazidime (30 μg) and cefotaxime (30 μg) disks alone and combined with clavulanic acid (10μg) on Muller Hinton agar. The positive test result was determined as ≥5 mm elevation in the diameter of the zone compared to a disk free of clavulanic acid. Moreover, an imipenem-EDTA double disk synergy assay was adopted for evaluating MBL enzyme production. Improvements in the diameter of the inhibition zone in IMP+EDTA in comparison with IMP-only disks were determined as MBL producers.
Biofilm Formation Assay
This test was carried out on a microtiter plate. Standard overnight cultures (1.5×108 CFU/ml) were diluted 100 times in PBS. A volume of 200 µl of each culture dilution was transferred to separate wells of a 96-well, flat-bottomed polystyrene plate, and was incubat¬ed overnight at 37°C. After the process of incubation, the planktonic bacteria were discarded, the wells were delicately washed three times using sterile physiological saline and were fixed using methanol for 20 min. Then, each well was stained using crystal violet and washed. Biofilm-related crystal violet was destained in 1 ml ethanol-acetone (95:5, vol/vol). Afterwards, the optical density of the mixed solution was found to be 600 nm. Isolates with OD > 0.625 were categorized to be biofilm-positive [ 39 ].
Extraction of DNA
A colony of each bacterial strain was purified and bacterial genomic DNA was extracted by a GenElute Bacterial Genomic Kit (Sigma-Aldrich, St Louis, MO).
Phylogenetic Typing of E. coli Isolates
Bacterial phylogenetic groups were determined using the previously described method of quadruplex phylogroup assignment [ 12 ]. The isolates were categorized in phylogenetic groups A, B1, B2, C, D, and F via scoring the presence or absence of genes in arpA/chuA/yjaA/TspE4.C2 order according to the following criteria: A: (+---); B1: (+--+); B2: (-++-/-+++/-+-+); F: (-+--); A or C: (+-+-); D or E: (++--/++-+); E or clade I: (+++-). The three last ones were screened using C or E-specific primers.
PCR Screening for Biofilm-Associated Genes
The frequency of four hypothetical biofilm-related genes in biofilm-former E. coli isolates has been investigated by Olowe et al. (2019). Table 1 shows the utilized primers. Extracted nucleic acid was adopted as template DNA for PCR. PCR was carried out based on a total volume of 25 mL, including 0.5 ml dNTPs (10 mM), 5 mL enzyme buffer (10X), 3 ml forward/reverse primers (10 pmol), 2 ml template DNA (2 mg), 0.5 mL enzyme (2.5 U), and 14 ml deionized water. Each gene was individually expanded and PCR products were assessed by electrophoresis on 1% agarose gel. Afterwards, PCR products were sequenced to affirm the identity of the amplicon sequence (Bioneer, South Korea).
PCR Screening for Antimicrobial Resistance Genes
Based on the patterns of antimicrobial susceptibility, PCR was performed for evaluating the corresponding antimicrobial resistance genes. Isolates showing resistance to investigated antimicrobial classes were screened regarding the existence of 14 diverse resistance genes by PCR as described before (Table 4). Tetracycline-resistance genes (tetA and tetB), sulfamethoxazole-resistance genes (sul1, sul2), TMP-resistance genes (dfr1), streptomycin-resistance genes (strA-strB), blaTEM, and blaSHV were screened. Furthermore, the existence of plasmid-mediated quinolone-resistance genes (qnrA, qnrB), and genes encoding aminoglycoside-modifying enzymes (aadA and aadB) were investigated. Table 2 demonstrates the sequences of oligonucleotide primers adopted in this evaluation. The conditions of PCR reactions were as mentioned above.
| Gene | Primer Sequence (5′-3′) | Amplicon size (bp) | Annealing tem. (°C) | Ref. |
|---|---|---|---|---|
| blaTEM | F-CTAGTATGACGTCTGTCGC | 1080 | 58 | [ 15 ] |
| R-GACAGTTACCAATGCTTAATC | ||||
| blaSHV | F-TTATCTCCCTGTTAGCCACC | 795 | 58 | [ 15 ] |
| R-GATTTGCTGATTTCGCTCGG | ||||
| qnr A | F-ATTTCTCACGCCAGGATTTG | 516 | 53 | [ 15 ] |
| R-GATCGGCAAAGGTTAGGTCA | ||||
| qnr B | F-GATCGTGAAAGCCAGAAAGG | 469 | 54 | [ 15 ] |
| R-ACGATGCCTGGTAGTTGTCC | ||||
| tetA | F-CCTCAATTTCCTGACGGGCT | 712 | 55 | [ 15 ] |
| R-GGCAGAGCAGGGAAAGGAAT | ||||
| tetB | F-ACCACCTCAGCTTCTCAACG | 586 | 55 | [ 15 ] |
| R-GTAAAGCGATCCCACCACCA | ||||
| strA-strB | F- ATG GTG GAC CCT AAA ACT CT | 893 | 60 | [ 16 ] |
| R- CGT CTA GGA TCG AGA CAA AG | ||||
| aadA | F- GTG GAT GGC GGC CTG AAG CC | 525 | 60 | [ 16 ] |
| R- AAT GCC CAG TCG GCA GCG | ||||
| aadB | F-GAG GAG TTG GAC TAT GGA TT | 208 | 53 | [ 16 ] |
| R- CTT CAT CGG CAT AGT AAA A | ||||
| cat I | F-AGTTGCTCAATGTACCTATAACC | 585 | [ 17 ] | |
| R-TTGTAATTCATTAAGCATTCTGCC | ||||
| cat II | F-ACACTTTGCCCTTTATCGTC | [ 17 ] | ||
| R-TGAAAGCCATCACATACTGC | ||||
| sul 1 | F- CGG CGT GGG CTA CCT GAA CG | 433 | 66 | [ 16 ] |
| R-GCC GAT CGC GTG AAG TTC CG | ||||
| sul 2 | F-CGG CAT CGT CAA CAT AAC CT | 721 | 66 | [ 16 ] |
| R-TGT GCG GAT GAA GTC AGC TC | ||||
| dfr1 | F-ACGGATCCTGGCTGTTGGTTGGACGC | 254 | 55 | [ 17 ] |
| R-CGGAATTCACCTTCCGGCTCGATGTC | ||||
| fimH | F-TGCAGAACGGATAAGCCGTGG | 506 | [ 18 ] | |
| R- GCAGTCACCTGCCCTCCGGTA | ||||
| csgA | F-GCAATCGTATTCTCCGGTAG | 418 | [ 18 ] | |
| R –GATGAGCGGTCGCGTTGTTA | ||||
| papC | F-TGATATCACGCAGTCAGTAGC | 501 | [ 18 ] | |
| R- CCGGCCATATTCACATAAC | ||||
| fliC | F-ATGGCACAAGTCATTAATACCCAAC | 1497 | [ 18 ] | |
| R- CTAACCCTGCAGCAGAGACA |
Statistical analysis
Correlations between the phylogenetic group, biofilm-forming ability, and frequency of resistance-related genes in examined bacteria were assessed by SPSS Statistics and the Chi-square test. For all tests, p < 0.05 was considered significant.
Acknowledgements
The author is acknowledgment to Islamic Azad University, Rasht Branch for support.
Competing Interests
There is no any conflict of interests.
Abbreviations-Cont'd
Imipenem
CFU: Colony Forming Unit
OD: Optical Density
References
- Melo LC, Oresco C, Leigue L, Netto HM, Melville PA, Benites NR, et al. Prevalence and molecular features of ESBL/pAmpC-producing Enterobacteriaceae in healthy and diseased companion animals in Brazil. Veterinary microbiology. 2018; 221:59-66. DOI
- Badger S, Abraham S, Saputra S, Trott DJ, Turnidge J, Mitchell T, et al. Relative performance of antimicrobial susceptibility assays on clinical Escherichia coli isolates from animals. Veterinary microbiology. 2018; 214:56-64. DOI
- Herrero M, Grace D, Njuki J, Johnson N, Enahoro D, Silvestri S, et al. The roles of livestock in developing countries. Animal. 2013; 7(s1):3-18. DOI
- Wolny-Koładka K, Lenart-Boroń A. Antimicrobial resistance and the presence of extended-spectrum beta-lactamase genes in Escherichia coli isolated from the environment of horse riding centers. Environmental Science and Pollution Research. 2018; 25(22):21789-800. DOI
- Johns I, Verheyen K, Good L, Rycroft A. Antimicrobial resistance in faecal Escherichia coli isolates from horses treated with antimicrobials: A longitudinal study in hospitalised and non-hospitalised horses. Veterinary microbiology. 2012; 159(3-4):381-9. DOI
- Beard L. Multiple drug resistant bacteria in equine medicine: An emerging problem. Equine Veterinary Education. 2010; 22(6):287-9.
- Damborg P, Marskar P, Baptiste KE, Guardabassi L. Faecal shedding of CTX-M-producing Escherichia coli in horses receiving broad-spectrum antimicrobial prophylaxis after hospital admission. Veterinary microbiology. 2012; 154(3-4):298-304. DOI
- Chung YS, Song JW, Kim DH, Shin S, Park YK, Yang SJ, et al. Isolation and characterization of antimicrobial-resistant Escherichia coli from national horse racetracks and private horse-riding courses in Korea. Journal of veterinary science. 2016; 17(2):199-206. DOI
- Von Wintersdorff CJ, Penders J, Van Niekerk JM, Mills ND, Majumder S, Van Alphen LB, et al. Dissemination of antimicrobial resistance in microbial ecosystems through horizontal gene transfer. Frontiers in microbiology. 2016; 7:173. DOI
- Kaspar U, von Lützau K, Schlattmann A, Rösler U, Köck R, Becker K. Zoonotic multidrug-resistant microorganisms among non-hospitalized horses from Germany. One Health. 2019; 7:100091. DOI
- Vangchhia B, Abraham S, Bell JM, Collignon P, Gibson JS, Ingram PR, et al. Phylogenetic diversity, antimicrobial susceptibility and virulence characteristics of phylogroup F Escherichia coli in Australia. Microbiology. 2016; 162(11):1904-12.
- Clermont O, Christenson JK, Denamur E, Gordon DM. The C lermont Escherichia coli phylo‐typing method revisited: improvement of specificity and detection of new phylo‐groups. Environmental microbiology reports. 2013; 5(1):58-65. DOI
- Erb A, Stürmer T, Marre R, Brenner H. Prevalence of antibiotic resistance in Escherichia coli: overview of geographical, temporal, and methodological variations. European Journal of Clinical Microbiology & Infectious Diseases. 2007; 26(2):83-90. DOI
- Chuppava B, Keller B, Meißner J, Kietzmann M, Visscher C. Effects of different types of flooring design on the development of antimicrobial resistance in commensal Escherichia coli in fattening turkeys. Veterinary microbiology. 2018; 217:18-24. DOI
- Ewers C, Bethe A, Semmler T, Guenther S, Wieler L. Extended-spectrum β-lactamase-producing and AmpC-producing Escherichia coli from livestock and companion animals, and their putative impact on public health: a global perspective. Clinical Microbiology and Infection. 2012; 18(7):646-55. DOI
- Walther B, Tedin K, Lübke-Becker A. Multidrug-resistant op portunistic pathogens challenging veterinary infection control. Veterinary microbiology. 2017; 200:71-8. DOI
- de Lagarde M, Larrieu C, Praud K, Schouler C, Doublet B, Sallé G, et al. Prevalence, risk factors, and characterization of multidrug resistant and extended spectrum β‐lactamase/AmpC β‐lactamase producing Escherichia coli in healthy horses in France in 2015. Journal of veterinary internal medicine. 2019; 33(2):902-11. DOI
- Allen SE, Boerlin P, Janecko N, Lumsden JS, Barker IK, Pearl DL, et al. Antimicrobial resistance in generic Escherichia coli isolates from wild small mammals living in swine farm, residential, landfill, and natural environments in southern Ontario, Canada. Applied and Environmental Microbiology. 2011; 77(3):882-8. DOI
- Maddox T, Clegg P, Diggle P, Wedley A, Dawson S, Pinchbeck G, et al. Cross‐sectional study of antimicrobial‐resistant bacteria in horses. Part 1: Prevalence of antimicrobial‐resistant Escherichia coli and methicillin‐resistant Staphylococcus aureus. Equine veterinary journal. 2012; 44(3):289-96. DOI
- Dolejska M, Duskova E, Rybarikova J, Janoszowska D, Roubalova E, Dibdakova K, et al. Plasmids carrying bla CTX-M-1 and qnr genes in Escherichia coli isolates from an equine clinic and a horseback riding centre. Journal of Antimicrobial Chemotherapy. 2011; 66(4):757-64. DOI
- Walther B, Klein K-S, Barton A-K, Semmler T, Huber C, Wolf SA, et al. Extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli and Acinetobacter baumannii among horses entering a veterinary teaching hospital: The contemporary" Trojan Horse". PloS one. 2018; 13(1):e0191873. DOI
- Ahmed MO, Clegg PD, Williams NJ, Baptiste KE, Bennett M. Antimicrobial resistance in equine faecal Escherichia coli isolates from North West England. Annals of clinical microbiology and antimicrobials. 2010; 9(1):1-7. DOI
- Sadikalay S, Reynaud Y, Guyomard-Rabenirina S, Falord M, Ducat C, Fabre L, et al. High genetic diversity of extended-spectrum β-lactamases producing Escherichia coli in feces of horses. Veterinary microbiology. 2018; 219:117-22. DOI
- Sato W, Sukmawinata E, Uemura R, Kanda T, Kusano K, Kambayashi Y, et al. Antimicrobial resistance profiles and phylogenetic groups of Escherichia coli isolated from healthy Thoroughbred racehorses in Japan. Journal of equine science. 2020; 31(4):85-91. DOI
- Moura I, Torres C, Silva N, Somalo S, Igrejas G, Poeta P. Genomic description of antibiotic resistance in Escherichia coli and enterococci isolates from healthy Lusitano horses. Journal of Equine Veterinary Science. 2013; 33(12):1057-63. DOI
- Bourély C, Cazeau G, Jarrige N, Jouy E, Haenni M, Lupo A, et al. Co-resistance to amoxicillin and tetracycline as an indicator of multidrug resistance in Escherichia coli isolates from animals. Frontiers in microbiology. 2019; 10:2288. DOI
- Johnson JR, Johnston BD, Delavari P, Thuras P, Clabots C, Sadowsky MJ. Phylogenetic backgrounds and virulence-associated traits of Escherichia coli isolates from surface waters and diverse animals in Minnesota and Wisconsin. Applied and environmental microbiology. 2017; 83(24):e01329-17. DOI
- Bortolami A, Zendri F, Maciuca EI, Wattret A, Ellis C, Schmidt V, et al. Diversity, virulence, and clinical significance of extended-spectrum β-lactamase-and pAmpC-producing Escherichia coli from companion animals. Frontiers in microbiology. 2019; 10:1260. DOI
- Reshadi P, Heydari F, Ghanbarpour R, Bagheri M, Jajarmi M, Amiri M, et al. Molecular characterization and antimicrobial resistance of potentially human pathogenic Escherichia coli strains isolated from riding horses. BMC Veterinary Research. 2021; 17(1):1-9. DOI
- Olowe OA, Adefioye OJ, Ajayeoba TA, Schiebel J, Weinreich J, Ali A, et al. Phylogenetic grouping and biofilm formation of multidrug resistant Escherichia coli isolates from humans, animals and food products in South-West Nigeria. Scientific African. 2019; 6:e00158. DOI
- Abdi HA, Rashki A. Comparison of virulence factors distribution in uropathogenic E. coli isolates from phylogenetic groups B2 and D. Int J Enteric Pathog. 2014; 2(4):1-5. DOI
- Chakraborty A, Saralaya V, Adhikari P, Shenoy S, Baliga S, Hegde A. Characterization of Escherichia coli phylogenetic groups associated with extraintestinal infections in South Indian population. Annals of medical and health sciences research. 2015; 5(4):241-6. DOI
- Hashemizadeh Z, Kalantar-Neyestanaki D, Mansouri S. Association between virulence profile, biofilm formation and phylogenetic groups of Escherichia coli causing urinary tract infection and the commensal gut microbiota: a comparative analysis. Microbial pathogenesis. 2017; 110:540-5.
- Phylogenetic typing and detection of extended-spectrum β-lactamases in Escherichia coli isolates from broiler chickens in Ahvaz, Iran. Veterinary Research Forum. 2016; 7(3): 227-233. DOI
- Platell JL, Johnson JR, Cobbold RN, Trott DJ. Multidrug-resistant extraintestinal pathogenic Escherichia coli of sequence type ST131 in animals and foods. Veterinary microbiology. 2011; 153(1-2):99-108. DOI
- Etebarzadeh Z, Oshaghi M, Amir Mozafari N. Evaluation of relationship between phylogenetic typing and antibiotic resistance of uropathogenic Escherichia coli. Journal of Microbial world. 2012; 4:84-92.
- Iranpour D, Hassanpour M, Ansari H, Tajbakhsh S, Khamisipour G, Najafi A. Phylogenetic groups of Escherichia coli strains from patients with urinary tract infection in Iran based on the new Clermont phylotyping method. BioMed research international2015; Article ID 846219.
- Wayne P. Clinical and Laboratory Standards Institute: Performance standards for antimicrobial susceptibility testing: 30 ed. CLSI supplement M100-S30. Clinical and Laboratory Standards Institute: Wayne, PA.
- Asadpour L. Antimicrobial resistance, biofilm-forming ability and virulence potential of Pseudomonas aeruginosa isolated from burn patients in northern Iran. Journal of global antimicrobial resistance. 2018; 13:214-20. DOI