Iranian Journal of Veterinary Science and Technology

Iranian Journal of Veterinary Science and Technology

Distribution of antimicrobial resistance and some widespread extended-spectrum beta-lactamase genes in different phylogroups of Shiga toxin-producing Escherichia coli (STEC) isolates of ruminant origin

Document Type : Research Article

Authors
1 Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran.
2 Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran
Abstract
Limited data is available on the prevalence of extended-spectrum beta-lactamase (ESBL) genes in Shiga toxin-producing Escherichia coli (STEC) isolates of ruminant origin. This study determined the molecular prevalence of ESBL-encoding genes (blaCTX-M, blaTEM, blaSHV and blaOXA) and antimicrobial-resistance (AMR) of 58 STEC isolates recovered from cattle (n= 32), sheep and goats (n= 26). In the current study, ESBL genes were identified by the molecular technique, while phenotypic AMR against six antibiotics (amoxicillin-clavulanic acid, tetracycline, neomycin, florfenicol, enrofloxacin and sulfamethoxazole-trimethoprim) were tested by disc diffusion method. Phylogenetic groups were also determined by a PCR scheme. Isolates were categorized into five phylogroups (A, B1, C, D and E) and B1 was the most prevalent phylogenetic group (43; 74.1%). Statistical analysis revealed significant association between phylogroup D and small ruminants (sheep and goats, p= 0.014). Moreover, the highest rates of antimicrobial resistance were related to tetracycline (25.9%) and neomycin (22.4%). Resistant isolates to tetracycline (p= 0.001), trimethoprim-sulfamethoxazole (p= 0.013) and neomycin (p= 0.000) were significantly prevalent among strains recovered from cattle. In addition, the majority of MDR strains were also had a significant distribution among cattle isolates (p= 0.001). In the current study, prevalence of ESBL positive STEC was 12.06% (7/58). Genes blaCTX-M and blaTEM were detected separately and in combination in bovine isolates. However, only one STEC strain of small ruminants harbored blaTEM. In conclusion, it seems that cattle isolates are notable sources of different AMR traits which could be a threat to veterinary sections, public health and food hygiene, in particular.
Keywords
Subjects

Abbreviations

ESBL: extended-spectrum beta-lactamase

STEC: Shiga toxin-producing Escherichia coli

AMR: antimicrobial-resistance

HC: hemorrhagic colitis

HUS: hemolytic uremic syndrome

Introduction

Human disease caused by STEC range from mild diarrhea to HC and potentially life-threatening HUS [ 1 ]. The STEC was the third most prevalent foodborne pathogens in the European Union which increased during the last decade [ 2 ]. Ruminants, particularly cattle, have been identified as the most major STEC reservoir. Furthermore, sheep and goats also play a key role in the spread of STECs into the food chain [ 3 ]. The STEC has also been isolated from wild animals, and has been reported as a safety risk in the production of fresh fruits and vegetables [ 4 ].

Antimicrobial misuse in animal production systems has sent a warning signal to the world's public health. This event resulted in the evolution of antibiotic-resistant strains, and it was with estimated that AMR caused disease mortality to rise from 700,000 in 2014 to 10 million by 2050 [ 5 ]. The AMR is regarded as a severe problem in healthcare settings because its mobile genetic elements can alter antibiotic resistance patterns in pathogenic and commensal E. coli, as well as the intestinal microbiota of animals and humans [ 6 ]. In contrast, little is known about AMR in STEC, particularly when it comes to broad-spectrum beta-lactamases, such as ESBLs from the blaCTX-M, blaTEM, blaOXA, and blaSHV families of ESBL variations [ 7 ]. Another issue with resistant-STEC is the spread of these ESBL-coding genes across other Enterobacterales, endowing them with antibiotic resistance [ 8 ]. Although the use of antibiotics to treat STEC infections is still controversial, antibiotics given early in the course of the infection may help to avoid HUS according to some studies [ 9 ]. In this scenario, the frequency of resistant-STEC strains is concern since disease progression continues unabated. The STEC has a high level of genomic plasticity, with mobile genetic components including plasmids, bacteriophages, and genomic islands playing a key role in the transmission of genes, particularly those involved in virulence [ 10 ].

The role of genetic background in antibiotic resistance has also been widely investigated in E. coli, but to the best of our knowledge has not been studied in ESBL genes among STEC. Based on some previous research, certain members of phylogenetic groups A and D are prone to acquire resistance against third-generation cephalosporins, while B2 strains are more vulnerable [ 11 ]. A multiplex PCR, which can classify E. coli isolates into eight phylogenetic groups, is the most practical approach for identifying phylogroups A, B1, C, E, D, F, B2, and E. Clades. E. coli strains are not randomly dispersed among bacterial populations. Therefore, phylotyping is a useful tool in different genotyping studies. Pathogenicity, niche, and resistance features of the members of the same group tend to be similar [ 12 ]. In the present study, we evaluated the STEC isolates of ruminant origin (sheep, goats, and cattle) to build a clear picture of status of AMR, and some important resistance genes in 58 STEC isolates recovered in recent years. Results would help combat AMR in both veterinary and public health sections.

Results

Phylogenetic groups

We classified 58 STEC isolates into five phylogroups (A, B1, C, D, and E) according to Clermont’s phylogrouping method. Members of groups A, B1, and C were identified among all the sources, while group D was only related to sheep and goats (5/26) and E was only detected in cattle (1/32). Moreover, group B1 was the most prevalent phylogenetic group in all sources (sheep and goats: 17/27, 29.3%; cattle: 26/32, 44.8%) and overall (43/58; 74.1%). Statistical analysis revealed a significant association between phylogroup D and small ruminants (p = 0.014). No other notable relations were observed. The results are represented in details in table 1.

Source (n) Phylogenetic groups
A B1 C D E
Cattle (32) 4 (6.9%) 26 (44.8%) 1 (1.7%) 0 1 (1.7%)
Sheep / Goats (26) 2 (3.4%) 17 (29.3%) 2 (3.4%) 5 (8.6%) 0
Total (58) 6 (10.3%) 43 (74.1%) 3 (5.2%) 5 (8.6%) 1 (1.7%)
p-value 0.681 0.231 0.582 0.014* 1.000
*significant difference (p < 0.05).
Table 1.Distribution of STEC isolates in five phylogenetic groups.

Antibiotic resistance

Phenotypic resistance:

A total of 58 isolates were investigated for phenotypic resistance to six different antibiotics, including: tetracycline (TET), trimethoprim-sulfamethoxazole (SXT), amoxicillin-clavulanic acid (AMC), neomycin (NEO), florfenicol (FLO) and enrofloxacin (ENFX), by disk diffusion method. The highest rates of antimicrobial resistance were related to tetracycline (25.9%) and neomycin (22.4%). Moreover, resistant isolates to tetracycline (p = 0.001), trimethoprim-sulfamethoxazole (p = 0.013), and neomycin (p = 0) were significantly prevalent among strains recovered from cattle. In addition, the majority of MDR strains also had a significant distribution among cattle isolates (p = 0.001). Table 2, represents the results in details.

Source (n) Antibiotics MDR ESBL genes
TET SXT AMC NEO FLO ENFX blaCTX-M blaTEM
Cattle (32) 14 (24.1%) 7 (12.1%) 3 (5.2%) 13 (22.4%) 3 (5.2%) 0 13 (22.4%) 5 (8.6%) 2 (3.4%)
Sheep / Goats (26) 1 (1.7%) 0 3 (5.2%) 0 0 1 (1.7%) 1 (1.7%) 0 1 (1.7%)
Total (58) 15 (25.9%) 7 (12.1%) 6 (10.3%) 13 (22.4%) 3 (5.2%) 1 (1.7%) 14 (24.1%) 5 (8.6%) 3 (5.2%)
p-value 0.001* 0.013* 1.000 0.000* 0.245 0.448 0.001* 0.058 1.000
*significant difference (p < 0.05).
Table 2.Frequency of phenotypic antimicrobial resistance and ESBL genes of STEC isolates (n, %).

ESBL/β-Lactamase genes:

Isolates were screened for four widespread ESBL/ β-Lactamase genes, namely blaCTX-M, blaTEM, blaSHV, and blaOXA gene families. The genes blaSHV and blaOXA were absent among the STEC isolates. Moreover, only seven isolates (12.06%) possessed ESBL genes. Among them, one isolate harbored blaCTX-M and blaTEM simultaneously, while the remaining six strains carried only one gene. Furthermore, the gene blaCTX-M was only present in cattle isolates. Figure 1 and table 2, represent the results in details.

Figure 1. AMR patterns for 22 resistant STEC isolates. Black = having resistance genes/not susceptible; White = no gene/susceptible; Gray = MDR; * = ESBL +

Correlations:

Correlations between AMR, ESBL genes, and MDR were measured and presented in details in table 3. Notable strong correlations were observed between tetracycline and neomycin with each other, and MDR.

rho TET SXT AMC NEO FLO ENFX blaCTX-M blaTEM MDR
p-value
TET - 0.627* 0.187 0.910* 0.395* -0.078 0.239 0.218 0.955*
SXT 0.000 - -0.126 0.689* 0.630* -0.049 0.075 -0.087 0.657*
AMC 0.159 0.347 - 0.089 -0.079 -0.045 0.097 0.432* 0.205
NEO 0.000 0.000 0.507 - 0.435* -0.071 0.277* 0.248 0.953*
FLO 0.002 0.000 0.554 0.001 - -0.031 0.206 -0.055 0.414*
ENFX 0.559 0.715 0.737 0.595 0.818 - -0.041 -0.031 -0.075
blaCTX-M 0.070 0.577 0.467 0.035 0.121 0.762 - 0.206 0.257
blaTEM 0.101 0.518 0.001 0.061 0.684 0.818 0.121 - 0.232
MDR 0.000 0.000 0.122 0.000 0.001 0.577 0.051 0.080 -
The table, simultaneously represents p-values (numbers on the left side of the table diameter) and Spearman’s correlation coefficients (numbers on the right side of the table diameter); Colored cells: strong correlations (rho > 0.8); *: Correlation is significant (p < 0.05).
Table 3.Correlations among AMR, ESBL genes and MDR.

Distribution of antibiotic- resistant isolates among phylogenetic groups:

The majority of the isolates resistant to five antibiotics (all the antibiotics except enrofloxacin) and MDR were observed in group B1 as it was the most frequent phylogroup. Interestingly, all the blaCTX-M + and 66.6% of blaTEM + (2/3) strains also belonged to the isolates in phylogroup B1. The rest of the resistant isolates were scattered among groups A, D and E. Group C did not show any phenotypic resistance, while one of the blaTEM + strains was a member of group C. Statistical analysis revealed no significant difference in the distribution of antibiotic resistant isolates between phylogenetic groups; except for enrofloxacin, an important quinolone, which was significantly related to phylogenetic group D. However, based on the scarcity of the group D in our study such a difference cannot be conclusive. The results are represented in details in table 4.

Phylogroups (n) Antibiotics MDR ESBL genes
TET SXT AMC NEO FLO ENFX blaCTX-M blaTEM
A (6) 2 (33.3%) 0 1 (16.7%) 1 (16.7%) 0 0 1 (16.7%) 0 0
B1 (43) 12 (27.9%) 7 (16.3%) 5 (11.6%) 11 (25.6%) 3 (7%) 0 12 (27.9%) 5 (11.6%) 2 (4.7%)
C (3) 0 0 0 0 0 0 0 0 1 (33.3%)
D (5) 0 0 0 0 0 1 (20%) 0 0 0
E (1) 1 (100%) 0 0 1 (100%) 0 0 1 (100%) 0 0
Total 15 7 6 13 3 1 14 5 3
p value 0.205 0.596 0.849 0.189 0.894 0.029* 0.184 0.753 0.237
*significant difference (p < 0.05).
Table 4.Distribution of phenotypic antimicrobial resistance and ESBL genes in STEC belonging to different phylogroups (n, %).

Discussion

Today, it is well established that livestock is an important reservoir of pathogenic E. coli with public health significance [ 13 ]. The presence of STEC strains which are responsible for a wide range of clinical manifestations from mild diarrhea to HC and HUS in humans, has been shown in food-producing animals, especially cattle [ 14 , 15 ]. Emerging AMR in the STEC strains of animal and food sources is a public health threat, as the possibility of resistant genes acquisition by other bacteria is increased [ 16 ]. Among different AMR, ESBL has gained a lot of attention during the last decade and ESBL-producing E. coli strains have been isolated from livestock as well [ 17 , 18 ]. However, there is a lack of knowledge on the occurrence of ESBL among STEC strains in cattle, sheep and goats as they are one of the main suppliers of milk and meat in most parts of the world. From this perspective, the current study has been conducted to evaluate the prevalence of ESBL-encoding genes among the STEC isolates of ruminant origin.

In the present study, the prevalence of ESBL positive STEC was 12.06% (7/58) which is higher than the reports of Ewers et al., (2/149; 1.34%) and Elmonir et al., (7/100; 7%) [ 19 , 20 ]. In fact, there is a lack of literature relevant to ESBL in STEC for comparison, as most studies on ESBL-producing E. coli have been performed in the non-STEC isolates of ruminants. Furthermore, bovine is the main subject in such studies, whereas ovine and caprine are mostly neglected. In other words, although livestock is known as STEC reservoirs, only a few studies have addressed the ESBL-producing STEC in cattle, sheep, and goats [ 21 - 25 ]. Moreover, some of the mentioned studies have focused on food hygiene aspects [ 21 , 24 , 26 ], while attention to gut-isolated pathogens is also valuable, because the intestinal tract is a ‘melting pot’ and one of the suitable milieu for gene exchange among bacterial species [ 27 ].

To date, several types and subtypes of ESBL-encoding genes have been detected in meat, milk and stool samples of ruminants. For example, ESBL genes such as blaCMY [ 24 , 28 ], blaTEM [ 18 , 23 , 24 , 26 , 29 ], blaSHV [ 18 , 23 , 24 , 26 ], and ampC [ 22 , 24 ] have been reported in cattle as well as sheep and goats samples, while blaOXA has been only reported from bovine E. coli strains [ 18 ]. Moreover, combination of blaCTX-M + blaTEM seems to be more common in E. coli with animal origin [ 24 , 30 ]. It seems that blaCTX-M is the most prevalent ESBL-encoding gene in both bovine and small ruminant E. coli strains [ 18 , 21 - 24 , 26 , 28 , 29 ]. in the present study, blaCTX-M and blaTEM were detected separately and in combination in bovine isolates, whereas only blaTEM was identified in one strain of STEC of small ruminants. Our finding are in line with the mentioned reports.

In the present study, most of the ESBL-producing strains which were recovered from cattle belonged to group B1 (6/7; 85.71%). It has been shown that the ESBL positive E. coli strains of livestock are mostly related to phylogenetic groups A and B1 and a lesser extent are related to B2 and D which is similar to our results [ 23 , 26 , 28 , 30 , 31 ]. However, one of our isolates (1/7; 14.28%) which was recovered from small ruminants belonged to phylogenetic group C. As shown by Atlaw et al., (2021), the ESBL positive strains of sheep and goats could be rarely scattered among non-commensal groups such as C and E [ 31 ].

Although antibiotic therapy in infections caused by STEC is now contraindicated due to the elevated risk of HUS in some cases, research on using antibiotics that inhibits transcription or translation, such as rifamycins (alone or in combination with fluoroquinolones), showed promising results. This, may lead to changes in the treatment regimen using antibiotics in future [ 32 , 33 ]. Currently, the importance of the emergence and spread of AMR in STEC is getting clear. The more resistant traits STEC has, the poorer the response to therapeutic strategies will be. One of the well-known factors in the emergence of AMR in STEC is the extensive use of antibiotics in clinical and agricultural environments. Today, the occurrence and increase of AMR in the STEC of various populations (human, livestock, companion animals,and the environment) have been documented [ 34 , 35 ]. In our research, resistance to tetracycline (25.9%), neomycin (22.4%), trimethoprim-sulfamethoxazole (12.1%) and amoxicillin-clavulanic acid (10.3%) was observed which is in line with other studies that have noted resistance to tetracycline, aminoglycosides, sulfonamides and β-lactams as the most horizontally acquired AMR in STEC [ 34 , 35 ].

Occurrence a positive strong correlation of resistance to tetracycline with MDR is one of the notable observation in the current study. This, can be partially confirmed by the results recorded by Bourely et al. (2019), which proposed the resistance to tetracycline and amoxicillin as an indicator for MDR in E. coli recovered from animals [ 36 ]. We indicated a strong correlation between neomycin resistance and MDR as well. However, there is a lack in literature relevant to this finding to be compared with.

In conclusion, ESBL-encoding STEC strains were detected in cattle, sheep, and goats in the present study. Moreover, bovine strains showed higher AMR in both ESBL positive and ESBL negative STEC isolates which could be due to the extensive application of antibiotics in the cattle industry for therapeutic and non-therapeutic purposes, such as growth promotion [ 36 , 37 ]. As antibiotic use can lead to a pressure for the emergence and spread of AMR, it seems that more caution should be taken in the veterinary field for antibiotic application especially in sections related to cattle.

E. coli Isolates

A panel of 58 non-duplicate archived STEC E.coli isolates was chosen from the bacterial collection (Ferdowsi University of Mashhad, Iran), including 32 isolates from cattle, and 26 isolates from sheep and goats. These bacteria were isolated during 2010 - 2018 in the context of different previous studies and surveyed for the presence of stx genes. In brief, the original sampling procedure included collecting fecal samples using sterile cotton swabs from the rectum of animals. In cases with a sample transfer time of more than 24 h, Amies (Oxoid, UK) transfer medium was used. The samples were cultured on MacConkey agar (Merck, Germany) and a pure isolate from each sample was confirmed as E. coli using standard biochemical tests [ 38 ]. All mentioned isolates were cryopreserved as stocks at -70 ˚C and recovered on Brain Heart Infusion broth (Merck, Germany) with the subsequent additional streak on MacConkey agar to confirm the purity.

To confirm the identity of the STEC isolates, a PCR protocol proposed by Lin et al., (1993) was applied based on the recognition of a common sequence of different stx types or subtypes. Each PCR reaction was performed in a volume of 20 µl containing: 10 µl Taq DNA Polymerase Master Mix RED 2x (Amplicon, Denmark) containing 1.5 mM MgCl2, 1 µl of each primers (Macrogen, Seoul, South Korea), ultrapure water and 300 ng of template DNA. Primer characteristics and thermal conditions are shown in Table 5. Finally, PCR products were analyzed by electrophoresis using 1.5% (w/v) agarose gel and Green Viewer safe stain (0.01 v/v) [ 39 ].

Panel Primer pair Sequence (5′ to 3′) Annealing temp (°C) Product size (bp) Ref.
STEC stx F: GAACGAAATAATTTATATGT 43 900 [ 39 ]
R: TTTGATTGTTACAGTCAT
Phylogenetic grouping
Quadruplex chuA F: ATGGTACCGGACGAACCAAC 59 288 [ 12 ]
R: TGCCGCCAGTACCAAAGACA
yjaA F: CAAACGTGAAGTGTCAGGAG 211
R: AATGCGTTCCTCAACCTGTG
TspE4.C2 F: CACTATTCGTAAGGTCATCC 152
R: AGTTTATCGCTGCGGGTCGC
arpA F: AACGCTATTCGCCAGCTTGC 400
R: TCTCCCCATACCGTACGCTA
Group E arpA F: GATTCCATCTTGTCAAAATATGCC 57 219
R: GAAAAGAAAAAGAATTCCCAAGAG
Group C trpA F: AGTTTTATGCCCAGTGCGAG 59 489
R: TCTGCGCCGGTCACGCCC
ESBL genes
Triplex blaTEM F: CATTTCCGTGTCGCCCTTATTC 57 800 [ 42 ]
R: CGTTCATCCATAGTTGCCTGAC
blaSHV F: AGCCGCTTGAGCAAATTAAAC 713
R: ATCCCGCAGATAAATCACCAC
blaOXA F: GGCACCAGATTCAACTTTCAAG 564
R: GACCCCAAGTTTCCTGTAAGTG
Uniplex blaCTX-M F: ATGTGCAGYACCAGTAARGTKATGGC 61 593 [ 43 ]
R: TGGGTRAARTARGTSACCAGAAYCAGCGG
Table 5.Primers used in the present study (STEC, Phylogenetic groups and ESBL genes)

DNA Extraction

The crude DNA was extracted using a boiling method as described before [ 40 ]. In brief, a suspension of three colonies from an overnight culture (18-20 h) was selected and prepared in sterile tubes containing 300 µl of sterile distilled water. The tubes were boiled in a boiling water bath for 10 min and after cooling on ice buckets centrifuged at 800×g for 5 min. The supernatant was used as a DNA template in the PCR.

Determination of phylogenetic groups

Phylogenetic groups of the isolates were investigated using the updated method developed by Clermont et al., (2013). The method enables an E. coli isolate to be assigned to one of the eight phylogroups (A, B1, B2, C, D, E, F, Clade I) and also allows isolates that are the members of other cryptic clades (II - V) of Escherichia to be identified. However, some isolates which cannot be categorized as mentioned groups, are known as ‘unknown’. The method consists of a primary quadruplex PCR reaction and additional PCR reactions, when necessary [ 12 ].

Each PCR reactions was performed in a volume of 20 µl containing: 10 µl Taq DNA Polymerase Master Mix RED 2x (Amplicon, Denmark) containing 1.5 mM MgCl2, various concentrations of each primers (Macrogen, Seoul, South Korea), ultrapure water, and 300 ng of template DNA. Thermal conditions and primer characteristics are shown in Table 5. Finally, PCR products were analyzed by electrophoresis using 1.5% (w/v) agarose gel and Green Viewer safe stain (0.01 v/v).

Antimicrobial resistance

Phenotypic resistance:

Antimicrobial susceptibility was conducted according to the CLSI recommendations using the disc diffusion method [ 41 ]. The antibiotics (Padtan Teb, Tehran, Iran) were chosen from six families of widely used antibiotics in humans and/or animals including: amoxicillin-clavulanic acid (AMC, 20/10 µg), tetracycline (TET, 30 µg), and neomycin (NEO, 30 µg), florfenicol (FLO, 30 µg), enrofloxacin (ENFX, 5 µg), sulfamethoxazole-trimethoprim (SXT, 1.25/23.75 µg). The isolates that showed resistance against three or more families of antimicrobials were designated as MDR.

ESBL genes:

Molecular detection of ESBL-producing E. coli was carried out using using a triplex PCR reaction for blaTEM, blaSHV,and blaOXA and a uniplex PCR for blaCTX-M. Each PCR reaction was performed in a volume of 20 µl containing: 10 µl Taq DNA Polymerase Master Mix RED 2x (Amplicon, Denmark) containing 1.5 mM MgCl2, various concentrations of each primers (Macrogen, Seoul, South Korea), ultrapure water and 300 ng of template DNA. Primer characteristics and thermal conditions are shown in Table 5. Finally, PCR products were analyzed by electrophoresis using 1.5% (w/v) agarose gel and Green Viewer safe stain (0.01 v/v).

Statistical analysis

In addition to the descriptive analysis of the results, possible relationships of genetic criteria (phylogenetic groups and ESBL genes) with phenotypic AMR were assessed by the chi-squared test and Fisher’s exact test. Correlation among AMR, ESBL genes and MDR were also measured and represented using Spearman rank-order correlation coefficient (rho). For all the analysis, p < 0.05 was considered significant. Moreover, correlations with rho > 0.8 were categorized as “strong correlation”. In the present study, the data were analyzed by SPSS version 16.0 (SPSS Inc., Chicago, USA).

Authors' Contributions

Conceptualization, G.H. and M.A.; Methodology, Rw.T. and H.K.R.; Software, H.K.R.; Supervision, G.H. and M.A.; Writing – original draft, R.T. and H.K.R.; Writing – review & editing, Rw.T., H.K.R., G.H., R.T. and M.A. All authors have read and agreed to the published version of the manuscript.

Acknowledgements

This study was funded by Faculty of Veterinary Medicine, Ferdowsi University of Mashhad under the grant number 48879.

Competing Interests

The authors declare that there is no conflict of interest.

References

  1. E tcheverría AI, Padola NL. Shiga toxin-producing Escherichia coli: factors involved in virulence and cattle colonization. Virulence. 2013; 4(5):366-72. DOI
  2. EFS and ECDC (European Food Safety Authority and European Center for Disease Prevention and Control). The European Union One Health 2019 Zoonoses Report. EFSA J. 2021; 19(2):6406-286. DOI
  3. Menge C. The Role of Escherichia coli Shiga Toxins in STEC Colonization of Cattle. Toxins (Basel).. 2020; 12(9):607. DOI
  4. Topalcengiz Z, Jeamsripong S, Spanninger PM, Persad AK, Wang F, Buchanan RL, et al. Survival of Shiga Toxin-Producing Escherichia coli in Various Wild Animal Feces That May Contaminate Produce. J Food Prot. 2020; 83(8):1420-9. DOI
  5. de Kraker MEA, Stewardson AJ, Harbarth S. Will 10 Million People Die a Year due to Antimicrobial Resistance by 2050? PLoS Med. 2016 Nov; 13(11):e1002184. DOI
  6. Djordjevic SP, Stokes HW, Roy Chowdhury P. Mobile elements, zoonotic pathogens and commensal bacteria: conduits for the delivery of resistance genes into humans, production animals and soil microbiota. Front Microbiol. 2013; 4:86. DOI
  7. Pavez-Muñoz E, González C, Fernández-Sanhueza B, Sánchez F, Escobar B, Ramos R, et al. Antimicrobial Usage Factors and Resistance Profiles of Shiga Toxin-Producing Escherichia coli in Backyard Production Systems From Central Chile. Front Vet Sci. 2020; 7:595149. DOI
  8. Stadler T, Meinel D, Aguilar-Bultet L, Huisman JS, Schindler R, Egli A, et al. Transmission of ESBL-producing Enterobacteriaceae and their mobile genetic elements—identification of sources by whole genome sequencing: study protocol for an observational study in Switzerland. BMJ Open. 2018; 8(2):e021823. DOI
  9. Davis TK, McKee R, Schnadower D, Tarr PI. Treatment of Shiga Toxin–Producing Escherichia coli Infections. Infect Dis Clin North Am. 2013; 27(3):577-97. DOI
  10. Cortimiglia C, Borney MF, Bassi D, Cocconcelli PS. Genomic Investigation of Virulence Potential in Shiga Toxin Escherichia coli (STEC) Strains From a Semi-Hard Raw Milk Cheese. Front Microbiol. 2020; 11:629189. DOI
  11. Tenaillon O, Skurnik D, Picard B, Denamur E. The Population Genetics of Comensal. Nat Rev Microbiol. 2010; 8:207-17. DOI
  12. Clermont O, Christenson JK, Denamur E, Gordon DM. The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups. Environ Microbiol Rep. 2013; 5(1):58-65. DOI
  13. Rwego IB, Gillespie TR, Isabirye-Basuta G, Goldberg TL. High Rates of Escherichia coli Transmission between Livestock and Humans in Rural Uganda. J Clin Microbiol. 2008; 46(10):3187-91. DOI
  14. Venegas-Vargas C, Henderson S, Khare A, Mosci RE, Lehnert JD, Singh P, et al. Factors Associated with Shiga Toxin-Producing Escherichia coli Shedding by Dairy and Beef Cattle. Appl Environ Microbiol. 2016; 82(16):5049-56. DOI
  15. G.M. Gonzalez A, M.F. Cerqueira A. Shiga toxin-producing Escherichia coli in the animal reservoir and food in Brazil. J Appl Microbiol. 2020; 128(6):1568-82. DOI
  16. Galarce N, Sánchez F, Fuenzalida V, Ramos R, Escobar B, Lapierre L, et al. Phenotypic and Genotypic Antimicrobial Resistance in Non-O157 Shiga Toxin-Producing Escherichia coli Isolated From Cattle and Swine in Chile. Front Vet Sci. 2020; 7DOI
  17. Benavides JA, Salgado-Caxito M, Opazo-Capurro A, González Muñoz P, Piñeiro A, Otto Medina M, et al. ESBL-Producing Escherichia coli Carrying CTX-M Genes Circulating among Livestock, Dogs, and Wild Mammals in Small-Scale Farms of Central Chile. Antibiot (Basel, Switzerland). 2021; 10(5)DOI
  18. Dahms C, Hübner N-O, Kossow A, Mellmann A, Dittmann K, Kramer A. Occurrence of ESBL-Producing Escherichia coli in Livestock and Farm Workers in Mecklenburg-Western Pomerania, Germany. PLoS One. 2015; 10(11):e0143326. DOI
  19. Ewers C, Stamm I, Stolle I, Guenther S, Kopp PA, Fruth A, et al. Detection of Shiga toxin- and extended-spectrum β-lactamase-producing Escherichia coli O145:NM and Ont:NM from calves with diarrhoea. J Antimicrob Chemother. 2014; 69(7):2005-7. DOI
  20. Elmonir W, Shalaan S, Tahoun A, Mahmoud SF, Remela EMA, Eissa R, et al. Prevalence, antimicrobial resistance, and genotyping of Shiga toxin-producing Escherichia coli in foods of cattle origin, diarrheic cattle, and diarrheic humans in Egypt. Gut Pathog. 2021; 13(1):8. DOI
  21. Dantas Palmeira J, Ferreira HMN. Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in cattle production - a threat around the world. Heliyon. 2020; 6(1):e03206. DOI
  22. Schmid A, Hörmansdorfer S, Messelhäusser U, Käsbohrer A, Sauter-Louis C, Mansfeld R. Prevalence of extended-spectrum β-lactamase-producing Escherichia coli on Bavarian dairy and beef cattle farms. Appl Environ Microbiol. 2013; 79(9):3027-32. DOI
  23. Ali T, ur Rahman S, Zhang L, Shahid M, Zhang S, Liu G, et al. ESBL-Producing Escherichia coli from Cows Suffering Mastitis in China Contain Clinical Class 1 Integrons with CTX-M Linked to ISCR1. Front Microbiol. 2016; 7DOI
  24. Obaidat MM, Gharaibeh WA. Sheep and goat milk in Jordan is a reservoir of multidrug resistant extended spectrum and AmpC beta-lactamases Escherichia coli. Int J Food Microbiol. 2022; 377:109834. DOI
  25. Xueliang Z, Haoyu Z, Zilian Z, Yongqiang M, Ruichao L, Baowei Y, et al. Characterization of Extended-Spectrum β-Lactamase-Producing Escherichia coli Isolates That Cause Diarrhea in Sheep in Northwest China. Microbiol Spectr. 2022; 10(4):e01595-22. DOI
  26. Abdallah HM, Al Naiemi N, Elsohaby I, Mahmoud AFA, Salem GA, Vandenbroucke-Grauls CMJE. Prevalence of extended-spectrum β-lactamase-producing Enterobacterales in retail sheep meat from Zagazig city, Egypt. BMC Vet Res. 2022; 18(1):191. DOI
  27. Zeng X, Lin J. Factors influencing horizontal gene transfer in the intestine. Anim Heal Res Rev. 2017; 18(2):153-9.
  28. Lee S, Teng L, DiLorenzo N, Weppelmann TA, Jeong KC. Prevalence and Molecular Characteristics of Extended-Spectrum and AmpC β-Lactamase Producing Escherichia coli in Grazing Beef Cattle. Front Microbiol. 2020; 10DOI
  29. Yang F, Zhang S, Shang X, Wang X, Wang L, Yan Z, et al. Prevalence and characteristics of extended spectrum β-lactamase-producing Escherichia coli from bovine mastitis cases in China. J Integr Agric. 2018; 17(6):1246-51. DOI
  30. Valentin L, Sharp H, Hille K, Seibt U, Fischer J, Pfeifer Y, et al. Subgrouping of ESBL-producing Escherichia coli from animal and human sources: An approach to quantify the distribution of ESBL types between different reservoirs. Int J Med Microbiol. 2014; 304(7):805-16. DOI
  31. Atlaw NA, Keelara S, Correa M, Foster D, Gebreyes W, Aidara-Kane A, et al. Identification of CTX-M Type ESBL E. coli from Sheep and Their Abattoir Environment Using Whole-Genome Sequencing. Pathog (Basel, Switzerland).. 2021; 10(11)DOI
  32. Mühlen S, Dersch P. Treatment Strategies for Infections With Shiga Toxin-Producing Escherichia coli. Front Cell Infect Microbiol. 2020; 10:169. DOI
  33. Puño-Sarmiento J, Anderson EM, Park AJ, Khursigara CM, Barnett Foster DE. Potentiation of Antibiotics by a Novel Antimicrobial Peptide against Shiga Toxin Producing E. coli O157:H7. Sci Rep. 2020; 10(1):10029. DOI
  34. Sanjana M, Blankenship HM, Rodrigues JA, Mosci RE, Rudrik JT, Manning SD. Antibiotic Susceptibility Profiles and Frequency of Resistance Genes in Clinical Shiga Toxin-Producing Escherichia coli Isolates from Michigan over a 14-Year Period. Antimicrob Agents Chemother. 2021; 65(11):e01189-21. DOI
  35. Mir RA, Kudva IT. Antibiotic-resistant Shiga toxin-producing Escherichia coli: An overview of prevalence and intervention strategies. Zoonoses Public Health. 2019; 66(1):1-13. DOI
  36. Bourély C, Cazeau G, Jarrige N, Jouy E, Haenni M, Lupo A, et al. Co-resistance to Amoxicillin and Tetracycline as an Indicator of Multidrug Resistance in Escherichia coli Isolates From Animals. Front Microbiol. 2019; 10:2288. DOI
  37. Landers TF, Cohen B, Wittum TE, Larson EL. A review of antibiotic use in food animals: perspective, policy, and potential. Public Health Rep. 2012; 127(1):4-22. DOI
  38. Zalewska M, Błażejewska A, Czapko A, Popowska M. Antibiotics and Antibiotic Resistance Genes in Animal Manure - Consequences of Its Application in Agriculture. Front Microbiol. 2021; 12:610656. DOI
  39. Markey B, Leonard F, Archambault M, Cullinane A, Maguire D. Clinical Veterinary Microbiology. Edinburgh: MOSBY ELSEVIER; 2013. ISBN: 9780723432371
  40. Lin Z, Kurazono H, Yamasaki S, Takeda Y. Detection of various variant verotoxin genes in Escherichia coli by polymerase chain reaction. Microbiol Immunol. 1993; 37(7):543-8. DOI
  41. Askari Badouei M, Joseph Blackall P, Koochakzadeh A, Haghbin Nazarpak H, Sepehri MA. Prevalence and clonal distribution of avian Escherichia coli isolates harboring increased serum survival (iss) gene. J Appl Poult Res. 2016; 25(1):67-73. DOI
  42. CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 27th ed. CLSI supplement M100. 2017. ISBN: 1-56238-805-3.
  43. Dallenne C, Da Costa A, Decré D, Favier C, Arlet G. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J Antimicrob Chemother. 2010; 65(3):490-5. DOI
  44. Monstein H-J, Ostholm-Balkhed A, Nilsson M V, Nilsson M, Dornbusch K, Nilsson LE. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS. 2007; 115(12):1400-8. DOI
Send comment about this article
Enter Name.
Enter a valid email address.
Enter a vaid affiliation.
Enter comments (At leaset 10 words)
CAPTCHA Image
Enter Security Code Correctly.

  • Receive Date 12 October 2022
  • Revise Date 06 December 2022
  • Accept Date 14 December 2022