Abbreviations
C. abortus: Chlamydophila abortus
PCR: polymerase chain reaction
PZ: plasticity zone
OMP: outer membrane protein
Introduction
The Chlamydia psittaci serotype 1 or Chlamydophila abortus is a non-motile, coccoid, obligate intracellular parasite from the family Chlamydiaceae. It has been recently given a new classification with 11 separate species. It is important as a causative agent of the reproductive system in a small ruminant [ 1 ]. C. abortus causes enzootic abortion in sheep, which is an infectious disease featured with placentitis and abortion. The complication decreases the breeding rate of sheep in different countries and it is not limited to sheep as it also affects goats and cattle [ 2 - 4 ]. The infected animals demonstrate no clinical signs until abortion or delivery of very weak lambs [ 2 - 4 ]. Normally, abortion happens during the last 2-3 weeks of pregnancy. There are reports that the abortion rate in one year age is low and increased to thirty percent at the age of two, followed by a 5-10% increase in the third year [ 5 ]. There are reports of latent infections for more than three years [ 6 ]. Pathological findings in this infection can begin in the third month of pregnancy. The finding in the placenta is exudate with yellow color, thickness in the membrane of cotyledons, and cotyledon color change to red [ 7 ].
To have a direct diagnosis, pathogen isolation, direct microscopic examination, serological tests, and DNA-based methods are used [ 8 , 9 ]. Isolation of chlamydia in cell culture is not easy and time-consuming. In the CFT test, cross-reactions between C. abortus and other bacteria like Acinetobacter can be observed [ 4 ]. There has been a surge in the conventional and real-time PCR use to identify C. abortus in clinical samples. To this end, the PCR methods are used with amplification on the chlamydial outer membrane protein (omp1, ompA, and omp2 genes), genes encoding 16S rRNA and helicase, the polymorphic membrane gene pmp, and the 16S-23S rRNA intergenic interval [ 10 - 12 ]. It is important to use rapid and reliable diagnostic tests for fast disease control. A highly sensitive method to find highly low copy number target DNA is nested-PCR. The nested-PCR method can find a variety of fastidious microorganisms with a significant increase in sensitivity and specificity [ 13 ].
While there are serological studies on C. abortus infection, our knowledge of the prevalence of C. abortus infections in sheep and goats’ milk in Iran is very limited. To date, seven C. abortus genome sequences have been published [ 14 , 15 ]. The UK strain S26/3 was the first reference genome, comprised of a 1.1 Mb chromosome and, unlike other Chlamydia, lacked any virulence-associated plasmid [ 16 ]. Two Greek isolates, LLG and POS, originating from the aborted fetuses of a goat and sheep respectively, represent the most diverse variant strains identified to date, with a further closely related strain recently described [ 17 ]. Two molecular typing schemes exist, using either multiple-locus variable-number tandem repeat analysis (MLVA), which has only identified seven MLVA sequence types (MTs) [ 18 ], or multiple locus sequence typing (MLST) [ 18 ], where only six MLST sequence types (STs) have been defined. This is in sharp contrast to greater diversity in other species of Chlamydia [ 19 ]. Studies on limited numbers of samples suggest that C. abortus isolates in livestock appear to be largely monomorphic: low diversity is observed throughout the genome, even within the plasticity zone , a region of high genomic variation in other chlamydial species [ 15 , 16 ]. Infections of C. abortus in sheep and goats have generally been documented serologically in West Azerbaijan province, in the North West of Iran. However, studies on pathogen isolation and detection by PCR are rare in this region. Therefore, we conducted this study to isolate C. abortus in sheep and goats in West Azerbaijan province, Iran, using the nested-PCR technique. We also conducted a phylogenetic analysis to compare our isolates with other Chlamydia species that were deposited in GenBank based on partial helicase gene sequence.
Results
Amplification of 16SrRNA gene
Among 360 milk samples collected from sheep and goats, 31 samples (8.61%, 95% CI = 6.13–11.96) were positive for chlamydia spp. amplifying a fragment of 127 bp of the 16S rRNA gene using nested-PCR. The prevalence of Chlamydia spp. in the milk of two examined species were statistically significant. The prevalence of C. abortus infection was significantly different in terms of regions with the highest frequency in the central region (Table 1). Animals with abortion history showed higher number of positive milk samples for C. abortus. In terms of seasonal prevalence, the highest number of positive samples for C. abortus was recorded in autumn. C. abortus was found in 17.24% of milk samples from animals more than 4-year-old, which was significantly higher than the other age groups (Table 1).
| Variable | Category | No. of examined milk samples (NO. of herd) | No. of positive sheep’s milk samples (NO. of herd) | No. of positive goat’s milk samples (NO. of herd) | Frequency of positive milk samples (%95 CI) | P value |
|---|---|---|---|---|---|---|
| Region | South | 120 (6) | 3 (2) | 1 (1) | 3. 33 (2.6.-7.98) | 0.00068 |
| North | 106 (5) | 4 (2) | 2 (1) | 5.66 (3.01-10.41) | ||
| Centre | 134 (7) | 14 (5) | 7 (4) | 15.67 (10.48-22.77) | ||
| History of abortion | With history | 160 | 15 | 8 | 14.38 (9.78-20.65) | 0.00048 |
| Without history | 200 | 6 | 2 | 4.00 (2.04-7.69) | ||
| Season | Spring | 99 | 5 | 1 | 6.06 (1.68-19.61) | 0.000022 |
| Summer | 88 | 1 | 1 | 2.22 (0.87-5.57) | ||
| Autumn | 87 | 9 | 7 | 18.18 (12.38-25.71) | ||
| Winter | 86 | 6 | 1 | 8.13 (2.79-3.01) | ||
| Age | < 2 years | 109 | 2 | 1 | 2.75 (0.94-7.78) | 0.015 |
| 2 – 4 years | 222 | 15 | 8 | 10.36 (7.00-15.07) | ||
| > 4 years | 29 | 4 | 1 | 17.24 (7.60-34.55) | ||
| Species | Sheep | 180 | 21 | - | 11.66 | 0.038 |
| Goat | 180 | - | 10 | 5.55 | ||
| Total | 360 (18) | 31 (9) | % 8.611 (%50) | |||
Amplification of ompA gene
Among 31 positive samples (16S-rRNA gene), all samples were positive with C. abortus amplifying a fragment of 479-bp of the ompA gene using PCR. In this study, only 31 cases (8.61%, 95% CI = 6.13–11.96) were identified as C. abortus in sheep and goats by producing a 479-bp fragment using PCR. (Figure 1).

Figure 1. Agarose gel image of an amplified fragment of the C. abortusompA gene (479 bp) using PCR. Lane 1, Positive control; Lane M, 100 bp DNA size marker (SMOBIO Technology INC., Taiwan); Lanes 2, 3, 4, 5, 6, 7, 8, and 9, positive samples for C. abortus; Lane 10, negative control.
Gel Extraction:
To identify C. abortus, PCR products containing 343-bp gene fragments were sent to (Pishgam Biotechnology Co.) for sequencing after gel purification (Expin Combo GP-mini, Co Gene All, South Korea). (Figure 2).

Figure 2. PCR amplification of partial helicase gene from C. abortus bacteria. M: 100-bp DNA size marker; Positive samples: 1, 2, 3, 4, 5, 6, 7, and 8; C: Negative control
Phylogenetic inferences
The phylogenetic tree was constructed based on the neighbor-joining analysis of helicase partial gene. This analysis revealed that two isolates of C. abortus were closely clustered with other C. abortus isolates from GenBank with more than 99.0% similarity (Figure 3).

Figure 3. Evolutionary analyses were conducted in MEGA X blast to show phylogenetic positioning of MT367602.1 and MT367603- C. abortus based on partial helicase gene, employing maximum likelihood available in GenBank sequences. Numbers on nodes indicate the bootstrap values.
Discussion
Chlamydia is the cause of a variety of pathological syndromes in small ruminants. Among many, the most common clinical expression of infection is abortion that brings notable financial losses and risks to human health, particularly in pregnant women [ 3 ]. The present study was the first-ever epidemiological study on C. abortus in sheep and goats in West Azerbaijan province. Results of the present study revealed that 8.1% of all examined raw milk samples were positive for Chlamydia spp. The prevalence of C. abortus in sheep and goats' raw milk has been reported by many researchers from Iran and other countries [ 24 - 26 ]. In a study in Mexico, the prevalence of C. abortus in goat milk was reported at 4.87% using the ELISA test [ 27 ]. Serological studies showed that 9% and 25% of sheep flocks of Khuzestan and Shahre-Kord provinces in Iran had antibodies against C. abortus, respectively [ 26 , 28 ]. Pinheiro Junior et al. showed that 21.5% of sheep in Alagoas-Brasilia had antibodies against C. abortus and 77.7% of the population had at least one seropositive animal [ 29 ]. Huang et al. reported that 20.9% of Tibetan sheep had chlamydial antibodies [ 30 ].
The results of the current study showed that the prevalence of the C. abortus in sheep's milk (11.67%) was significantly more than goats' milk (5.56%). A study in Mexico showed that the prevalence of C. abortus in sheep and goats was 22.6% and 4.9% respectively [ 27 ]. The prevalence of C. abortus in sheep and goats with an abortion history was 14.38% which was significantly higher than of those without abortion history [ 4 ]. This finding is consistent with other studies reported from Iran and other countries [ 24 , 28 ]. The reason for this finding is that protective immunity does not develop when non-pregnant sheep are infected, and it can result in abortion [ 31 , 32 ].
In a study in Iran, the prevalence of C. abortus in milk and other samples conducted by the molecular method in Tehran, Lorestan, Qom, Fars, Bushehr, East Azerbaijan, Khuzestan, and Chaharmahal va Bakhtiari provinces and results were 37.7%, 32.9%, 30.3%, 30.3%, 19.6%, 17.5%, 15.6%, and 52%, respectively [ 26 ]. The last reported finding is in accordance with those of Zaibet et al. [ 33 ] who reported that the risk of chlamydial infection in sheep is multiplied by 4 and 1.08 in the presence of cattle and goats on the same farm. We also found that flocks exposed to Chlamydiae showed not only risks of abortions, but also high sheep mortality rates. Indeed, chlamydial infection induces high animal mortality that finally reduces the financial capital of breeders and increases the costs of production [ 34 ]. Although the proportion of the positive sample in female sheep and goats was higher than male animals, sex was not significantly associated with the chance of seropositivity. Also, the seroprevalence of antibodies against C. abortus was not statistically different among age categories. Similar results were reported by McCauley et al. [ 35 ] who studied on seroprevalence of C. abortus in Australian sheep and Cubero-Pablo et al. [ 36 ] who reported seroepidemiology of chlamydial infection of wild ruminants in Spain. In a study in Turkey, the prevalence of C. abortus in ovine was 2.1% [ 37 ]. In other countries, the prevalence of chlamydia in milk was reported in the range of 3.70–61.0% so that the maximum and minimum prevalence of chlamydia in milk belonged to Sweden and Germany, respectively [ 27 , 38 - 43 ].
It was shown that the geographical location may be a risk factor for C. abortus infection in sheep and goats. In the present study, the results showed that in the central region, the frequency of positive milk samples for C. abortus was 15.67%, nearly five times higher than in the south region (3.33%). This finding indicates that the sheep and goats populations in the south region are at lower risk of infection. The highest prevalence of C. abortus was in the region surrounded by mountains and Plateau [ 24 , 26 , 28 ]. The reasons for these differences in the prevalence of C. abortus might be the high density of livestock population in the central region than south of West Azerbaijan province.
The results of the present study showed that animals in the age group >4-year-old had the highest prevalence of C. abortus (17.24%), which is in agreement with other studies [ 2 , 44 - 46 ]. Qin et al. reported a significant correlation between age and infection, a by the increase of the age, the seroprevalence of C. abortus infection went up all the time, indicating that there may be a cumulative likelihood for exposure to C. abortus infection with age [ 47 ]. In a study by Esmaeili et al., the prevalence of C. abortus infection in small ruminant flocks according to age was 23.91% in the age group of 5-6 years [ 45 ].
The seasonal prevalence of C. abortus infection ranged from 2.22% to 18.11%. The highest prevalence (18.11%) was in autumn, and the lowest was in summer (2.22%). This finding of the current study was in agreement with similar studies from Iran and other countries [ 48 ]. In a study by Shi-Feng Hu et al. [ 48 ] in a seasonal survey of the C. abortus, the higher prevalence was in the autumn season.
In the present study phylogenetic analysis based on helicase gene revealed that the two sequenced isolates were almost identical with more than 99% similarity with the other C. abortus isolates from GenBank. In a study by Seth-Smith et al., phylogenetic analysis of a total of 64 genomes shows a deep structural division within the C. abortus species with a major clade displaying limited diversity. Also, the number of variable nucleotide positions across the sampled isolates is significantly lower than those published for C. trachomatis and C. psittaci [ 49 ]. Finally, regarding the public health issue of chlamydiosis, we suggest serological and molecular surveys on other species of livestock in West Azerbaijan province and other provinces of Iran will be necessary to clarify the picture of C. abortus infection in the country.
The prevalence of C. abortus infection in sheep and goats' milk was determined for the first time in West Azerbaijan, Iran. It was concluded that sheep and goats can play an important role in the epidemiology of Chlamydiosis as the reservoir for C. abortus. Our study showed that genetic diversity appears to be very stable. The molecular detection of C. abortus using the nested-PCR method in milk samples showed that PCR can be used as an easy and reliable approach for detecting C. abortus. The prevalence of C. abortus was higher in sheep's milk than in goat. Therefore, the consumption of sheep milk exposes humans to a higher risk of Chlamydial infection.
Study areas
West Azerbaijan province is in the northwest of Iran with over 3.5 m population. Urmia city is the center of the province. This province has diverse climates and geographical areas (e.g. relatively flat terrains, mountains, and the coasts of Urmia Lake). The climate is mostly featured with rainy winds of the Mediterranean and the Atlantic Ocean (https://www.britannica.com/place/Azerbaijan-region-Iran) (Figure 4). This province is very important in agricultural and animal production in Iran.

Figure 4. The schematic map of the study areas, West Azerbaijan, Iran.
Milk sampling
A total number of 360 milk samples were randomly collected from sheep (n=180) and goats (n=180) belong to 36 different flocks in West Azerbaijan Province. The flocks were selected from three different geographical regions including the north, center, and south of the province. A total of 160 milk samples were from flocks with abortion history, and the other 200 samples were taken from flocks without abortion history throughout the year 2018. The sampled animals were classified into three age groups (<2 years old, 2-4 years old, and >4 years old). We avoided sampling from pregnant, early lactating dairy animals (<100 DIM) because the metabolic stress of early lactation may lead to immunosuppression and therefore, an increase in disease susceptibility [ 20 ]. There has been no attempt to determine the cause of abortion in flocks with abortion. The milk samples were placed next to ice and transferred to the microbiology laboratory of the faculty of veterinary medicine.
DNA Extraction
Initially, the samples processed following a protocol described by White et al. [ 21 ]. Genomic DNA Extraction Kit (Favorgen, Taiwan) was used to extract DNA from milk samples according to kit’s manufacturer instructions. The extracted DNA was quantified using NanoDrop 2000c (Thermo Scientific, USA) and kept at -20˚C until later use in PCR.
Amplification of 16s rRNA gene using Nested-PCR
Nested-PCR targeting the 16S rRNA gene was used for molecular detection of Chlamydia spp. Using primers described by Mesmer et al. [ 21 ] and modified by Longbottom et al. [ 8 , 22 ] (Table 2). The first stage of the nested-PCR carried out by using Taq DNA Polymerase Master Mix RED (Amplicon, Denmark). The PCR reaction was prepared in 25 μl volume consisting of 5 μl of DNA template, 50 picomole of each primer (16SIGF, 16SIGR), 12.5μl of the master mix, and 6.5 μl of distilled water. For the second stage, PCR reaction was prepared as described above, except for the DNA template, for which 2.5 μl of 1:100 diluted PCR product from the first stage was used. The thermal cycling condition was described according to Messmer et al. [ 21 ]. The PCR products were electrophoresed on a 1.5% and 2% agarose gel stained with safe stain (Quanta. England) for stages 1 and 2, respectively. The gels were visualized through Ingenius Gel Documentation (Syngene Bio-Imaging, UK) (Figure 5).

Figure 5. Agarose gel image of an amplified fragment of the C. abortus16S rRNA gene (127 bp) using nested-PCR. Lane 1, Positive control; Lane M, 100-bp DNA size marker (SMOBIO Technology Inc., Taiwan); Lanes 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15, positive samples for C. abortus; Lane C, negative control.
Amplification of the ompA gene in C. abortus
For the identification of C. abortusompA gene was amplified using primers previously described by Creelan et al. (Table 2). The PCR reaction was performed in 25 μl volume comprising 5 μl of extracted DNA, 50 pmol of each primer (ompA 1, ompA 2), and 12.5μl of master mix. Amplification conditions were described according to Creelan et al. Amplified products were electrophoresed on 1% (w/v) agarose gel containing safe stain and then visualized using Ingenius Gel Documentation (Syngene Bio-Imaging, UK) (Figure 1).
| Application | Primer Name | Sequence(5' to 3') | Amplicon length (bp) | PCR step (°C/seconds) | cycles | |||
|---|---|---|---|---|---|---|---|---|
| pre denaturation | Denaturation | Annealing | Extension | |||||
| PCR | 16SIGF | ACGGAATAATGACTTCGG | 436 | 95/180 | 94/30 | 70/30 | 72/45 | 45 |
| 16SIGR | TACCTGGTACGCTCAATT | |||||||
| Nested PCR | F | ATAATGACTTCGGTTGTT ATT | 127 | 95/120 | 94/60 | 55/30 | 72/60 | 35 |
| R | TGTTTTAGATGCCTAAACAT | |||||||
| PCR | OMPA-1 | TGGTATTCTTGCCGATGAC | 479 | 95/180 | 94/30 | 70/30 | 72/45 | 45 |
| OMPA-2 | GATCGTAACTGCTTAATAAACCG | |||||||
| PCR | 12SM-FW | CTAGAGGAGCCTGTTCTATAATCGATAA | 343 | 93/120 | 40 | 93/30 | 63/3 | 72/4 |
| 12SBT-REV2 | AAATAGGGTTAGATGCACTGAATCCAT | |||||||
Amplification of the Helicase gene in C. abortus
In order to amplify the helicase gene was used the PCR primers and conditions described by Cantekin, et al. [ 23 ] (Table 2).
Nucleotide sequencing
The PCR products of the helicase gene of C. abortus isolates were sent to SinaClon Company (Tehran, Iran) for sequencing. The obtained nucleotide sequences of the helicase gene were searched against GenBank (National Centre for Biotechnology Information, Rockville Pike, and Bethesda, USA) using the advanced BLAST similarity search option and compared to the helicase sequences of Chlamydia spp. from GenBank. Nucleotide sequences were aligned and compared to other nucleotide sequences from GenBank using Clustal-W and phylogenetic tree was generated using the neighbor-joining method in MEGA software (version X; Biodesign Institute, Tempe, USA).
Statistical analysis of data
The epidemiological data were analyzed using the Chi-square test in SPSS version 22 (IBM Corp. Armonk, NY, USA). Differences with a p value <0.05 were considered significant.
Authors' Contributions
FT and AO conceived and planned the experiments. FT, AO, and KM carried out the experiments. FT and AO contributed to sample preparation. AO and KM contributed to the interpretation of the results. All authors took the lead in writing the manuscript. All authors provided critical feedback and helped shape the research, analyses, and the manuscript.
Acknowledgement
The authors would like to thank Urmia University for funding the project.
Competing Interests
The authors declare that there is no conflict of interest.
References
- Selim A. Chlamydophila abortus Infection in Small Ruminants: A Review. Asian J Anim Vet Adv. 2016; 11:587-93.
- Longbottom D, Coulter L. Animal chlamydioses and zoonotic implications. J Comp Path. 2003; 128(4):217-44.
- Rodolakis A, Mohamad KY. Zoonotic potential of Chlamydophila. Vet Microbiol. 2010; 140(3-4):382-91.
- Sachse K, Vretou E, Livingstone M, Borel N, Pospischil A, Longbottom D. Recent developments in the laboratory diagnosis of chlamydial infections. Vet Microbiol. 2009; 135(1-2):2-21.
- Aitken I, Longbottom D. Chlamydial abortion. Diseases of sheep. 2007; 4(16):105-12.
- Morgan K, Wills J, Howard P, Williams Isolation of Chlamydia psittaci from the genital tract of lambs: a possible link with enzootic abortion of ewes. Vet Rec. 1998; 123 (15): 399-400.
- Livingstone M, Wheelhouse N, Ensor H, Rocchi M, Maley S, Aitchison K, et al. Pathogenic outcome following experimental infection of sheep with Chlamydia abortus variant strains LLG and POS. PLoS One. 2017; 12(5):e0177653.
- Longbottom D, Fairley S, Chapman S, Psarrou E, Vretou E, Livingstone M. Serological diagnosis of ovine enzootic abortion by enzyme-linked immunosorbent assay with a recombinant protein fragment of the polymorphic outer membrane protein POMP90 of Chlamydophila abortus. J Clin Microbiol. 2002; 40(11):4235-43.
- O'Neill L, Keane O, Ross P, Nally J, Seshu J, Markey B. Evaluation of protective and immune responses following vaccination with recombinant MIP and CPAF from Chlamydia abortus as novel vaccines for enzootic abortion of ewes. Vaccine. 2019; 37(36):5428-38.
- Arif ED, Saeed NM, Rachid SK. Isolation and Identification of Chlamydia abortus from Aborted Ewes in Sulaimani Province, Northern Iraq. Pol J Microbiol. 2020; 69(1):65.
- Barati S, Moori-Bakhtiari N, Najafabadi MG, Momtaz H, Shokuhizadeh L. The role of zoonotic chlamydial agents in ruminants abortion. Iran J Microbiol. 2017; 9(5):288-94.
- Everett KD. Chlamydia and Chlamydiales: more than meets the eye. Vet Microbiol. 2000; 75(2):109-26.
- Shatleh-Rantisi D, Tamimi A, Ashhab Y. Improving sensitivity of single tube nested PCR to detect fastidious microorganisms. Heliyon. 2020; 6(1):e03246.
- Thomson NR, Yeats C, Bell K, Holden MT, Bentley SD, Livingstone M, et al. The Chlamydophila abortus genome sequence reveals an array of variable proteins that contribute to interspecies variation. Genome research. 2005; 15(5):629-40.
- Sait M, Clark EM, Wheelhouse N, Livingstone M, Spalding L, Siarkou VI, et al. Genome sequence of the Chlamydophila abortus variant strain LLG. American Society For Microbiology. 2011; 193(16): 4276-4277.
- Joseph SJ, Marti H, Didelot X, Castillo-Ramirez S, Read TD, Dean D. Chlamydiaceae genomics reveals interspecies admixture and the recent evolution of Chlamydia abortus infecting lower mammalian species and humans. Genome biol evol. 2015; 7(11):3070-84.
- Siarkou VI, Vorimore F, Vicari N, Magnino S, Rodolakis A, Pannekoek Y, et al. Diversification and distribution of ruminant Chlamydia abortus clones assessed by MLST and MLVA. PLoS One. 2015; 10(5)
- Laroucau K, Vorimore F, Bertin C, Mohamd KY, Thierry S, Hermann W, et al. Genotyping of Chlamydophila abortus strains by multilocus VNTR analysis. Vet Microbiol. 2009; 137(3-4):335-44.
- Herrmann B, Isaksson J, Ryberg M, Tångrot J, Saleh I, Versteeg B, et al. Global multilocus sequence type analysis of Chlamydia trachomatis strains from 16 countries. J Clin Microbiol. 2015; 53(7):2172-9.
- Goff J, Horst R. Physiological changes at parturition and their relationship to metabolic disorders1, 2. J Dairy Sci. 1997; 80(7):1260-8.
- Messmer TO, Skelton SK, Moroney JF, Daugharty H, Fields BS. Application of a nested, multiplex PCR to psittacosis outbreaks. J Clin Microbiol. 1997; 35(8):2043-6.
- Li Z, Cao X, Fu B, Chao Y, Cai J, Zhou J. Identification and characterization of Chlamydia abortus isolates from yaks in Qinghai, China. Biomed Res Int. 2015;1-6.
- Cantekin Z, Solmaz H, Ergun Y, Ozmen M. Development of Polymerase Chain Reaction assays with host-specific internal controls for Chlamydophila abortus. Veterinarni Medicina. 2015; 60(1):1-5.
- Seroepidemiological feature of Chlamydia abortus in sheep and goat population located in northeastern Iran. Veterinary Research Forum; 2020: Faculty of Veterinary Medicine, Urmia University.
- Mahzounieh MR, Khoei HH, Niknejad M, Yektaneh F. Molecular detection of Chlamydia psittaci in fecal samples of asymptomatic parrots in Mazandaran, Iran. Pajoohandeh Journal. 2014; 18(6):337-43.
- Mahzouniyeh M, Golboui daghdari SH, Pourahmad R. Detection of Chlamydophila abortus abortions in sheep in the Chaharmahal-va-Bakhtiyari province, using Nested PCR. Vet J. 2014; 2:80-74.
- Campos-Hernández E, Vázquez-Chagoyán JC, Salem AZ, Saltijeral-Oaxaca JA, Escalante-Ochoa C, López-Heydeck SM, et al. Prevalence and molecular identification of Chlamydia abortus in commercial dairy goat farms in a hot region in Mexico. Trop Anim Health Prod. 2014; 46(6):919-24.
- Ghorbanpoor M, Bakhtiari N-M, Mayahi M, Moridveisi H. Detection of Chlamydophila psittaci from pigeons by polymerase chain reaction in Ahvaz. Iran J Microbiol. 2015; 7(1):18.
- Pinheiro Junior JW, Mota RA, Piatti RM, Oliveira AAdF, Silva AMd, Abreu SRdO, et al. Seroprevalence of antibodies to Chlamydophila abortus in ovine in the State of Alagoas, Brazil. Braz J Microbiol. 2010; 41:358-64.
- Huang S, Wu S, Xu M, Zhou D, Danba C, Gong G, et al. First record of Chlamydia abortus seroprevalence in Tibetan sheep in Tibet, China. Small Rumin Res. 2013; 112(1-3):243-5.
- Rocchi MS, Wattegedera S, Meridiani I, Entrican G. Protective adaptive immunity to Chlamydophila abortus infection and control of ovine enzootic abortion (OEA). Vet Microbiol. 2009; 135(1-2):112-21.
- Güler L, Hadimli H, Erganiş O, Ateş M, Ok Ü, Gündüz K. Field evaluation of a PCR for the diagnosis of chlamydial abortion in sheep. Vet Rec. 2006; 159(22):742-5.
- Zaibet L, Hammami S, Jabbar M. Sustainability of small ruminant production systems in Tunisia: A health marketing approach: International Livestock Research Institute. 2008; 17(5): 86-90.
- Hireche S, Bouaziz O, Djenna D, Boussena S, Aimeur R, Kabouia R, et al. Seroprevalence and risk factors associated with Chlamydophila spp. infection in ewes in the northeast of Algeria. Trop Anim Health Prod. 2014; 46(2):467-73.
- McCauley L, Lancaster M, Butler K, Ainsworth C. Serological analysis of Chlamydophila abortus in Australian sheep and implications for the rejection of breeder sheep for export. Aust Vet J. 2010; 88(1‐2):32-8.
- Cubero-Pablo M, Plaza M, Pérez L, González M, León-Vizcaíno L. Seroepidemiology of chlamydial infections of wild ruminants in Spain. J Wildl Dis. 2000; 36(1):35-47.
- Öngör H, Cetinkaya B, Acik M, Karahan M, Bulut H. Detection of Chlamydophila abortus in Ovine Milk by Immunomagnetic Separation–Polymerase Chain Reaction. J Vet Med Seri B. 2004; 51(1):43-5.
- Berri M, Bernard F, Lecu A, Ollivet-Courtois F, Rodolakis A. Molecular characterisation and ovine live vaccine 1B evaluation toward a Chlamydophila abortus strain isolated from springbok antelope abortion. Vet Microbiol. 2004; 103(3-4):231-40.
- Berri M, Rekiki A, Boumedine KS, Rodolakis A. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR. BMC Microbiol. 2009; 9(1):130.
- Godin A-C, Björkman C, Englund S, Johansson K-E, Niskanen R, Alenius S. Investigation of Chlamydophila spp. in dairy cows with reproductive disorders. Acta Vet Scand. 2008; 50(1):39.
- DeGraves FJ, Gao D, Hehnen H-R, Schlapp T, Kaltenboeck B. Quantitative detection of Chlamydia psittaci and C. pecorum by high-sensitivity real-time PCR reveals high prevalence of vaginal infection in cattle. J Clin Microbiol. 2003; 41(4):1726-9.
- Kemmerling K, Müller U, Mielenz M, Sauerwein H. Chlamydophila species in dairy farms: polymerase chain reaction prevalence, disease association, and risk factors identified in a cross-sectional study in western Germany. J Dairy Sci. 2009; 92(9):4347-54.
- Osman K, Ali H, ElJakee J, Galal H. Chlamydophila psittaci and Chlamydophila pecorum infections in goats and sheep in Egypt. Rev Sci Tech. 2011; 30(3):939.
- Aitken I, Clarkson M, Linklater K. Enzootic abortion of ewes. Vet Rec. 1990; 126(6):136.
- Esmaili H, Hamedi M, Boromanfar S. RE. National Guidelines for diagnosis, investigation and management of abortion complications ruminants. Theran: Academic Press. National Guidelines for diagnosis, investigation and management of abortion complications ruminants. 1391;103-10.
- Qin S-Y, Huang S-Y, Yin M-Y, Tan Q-D, Liu G-X, Zhou D-H, et al. Seroprevalence and risk factors of Chlamydia abortus infection in free-ranging white yaks in China. BMC veterinary research. 2015; 11(1):8.
- Qin S-Y, Yin M-Y, Cong W, Zhou D-H, Zhang X-X, Zhao Q, et al. Seroprevalence and risk factors of Chlamydia abortus infection in Tibetan sheep in Gansu province, northwest China. The Scientific World Journal. 2014;1-6.
- Hu S-F, Li F, Zheng W-B, Liu G-H. Seroprevalence and risk factors of Chlamydia abortus infection in goats in hunan province, subtropical China. Vector Borne Zoonotic Dis. 2018; 18(9):500-3.
- Seth-Smith H, Busó LS, Livingstone M, Sait M, Harris S, Aitchison K, et al. European Chlamydia abortus livestock isolate genomes reveal unusual stability and limited diversity, reflected in geographical signatures. BMC genomics. 2017; 18(1):1-10.