Abbreviations
E. coli: Escherichia coli
FQ: Fluoroquinolone
QRDR: Quinolone resistance determining region
MC: MacConkey
EMB: Eosin Methylene Blue
Introduction
Mastitis is considered one of the most important diseases in dairy animals that causes severe losses to the dairy industry [ 1 ]. The economic losses due to clinical mastitis include production loss, lower milk yield and value, treatment expenses, and loss of animal value [ 2 ]. Coliforms such as Escherichia, Klebsiella spp., and Enterobacter spp. are the most common etiological agents causing clinical mastitis [ 3 ]. Escherichia coli is the most common species isolated from coliform mastitis which is a Gram-negative, non-spore-forming rod bacterium that belongs to the family Enterobacteriaceae [ 4 , 5 ]. Clinical signs of E. coli mastitis include a wide range from a mild disease with only local inflammation changes in the mammary gland to severe with systemic signs, generally including high fever, increased pulse frequency, lack of appetite, decreased milk production, dehydration, rumen stasis, shock, and death [ 6 , 7 ]. In cases of mild to moderate E. coli mastitis, the use of anti-inflammatory drugs and supportive treatments is recommended. In peracute or acute cases of E. coli mastitis, due to the potential risk of bacterial growth in the mammary gland, which in turn may lead to bacteremia, administration of broad-spectrum antimicrobials is recommended to reduce the number of bacteria [ 8 ].
The fluoroquinolones are broad-spectrum and bactericidal antibiotics. They are used against gram-positive and especially gram-negative bacteria such as members of the Enterobacteriaceae family [ 9 , 10 ]. They block DNA synthesis by targeting bacterial DNA gyrase and topoisomerase IV, both of which are essential for bacterial DNA supercoiling as the replicating strands separate [ 11 ]. DNA gyrase and topoisomerase IV are tetrameric structures composed of two pairs of subunits. The four subunits of DNA gyrase include 2 monomers of A and 2 monomers of B, with the names GyrA and GyrB, respectively. The topoisomerase IV also has ParC and ParE subunits, which are encoded by parC and parE genes, respectively [ 12 ].
The major mechanisms of resistance to quinolone antibiotics include mutations that occur at the target drug sites, mutations that reduce drug accumulation, and plasmid-mediated quinolone resistance [ 13 ]. The most common mechanism that produces significant levels of clinical resistance to fluoroquinolones is an alteration in the target enzymes. These changes are caused by self-mutations occurring within the responsible genes. Resistance to fluoroquinolones is due to the substitution of amino acids in a certain region of GyrA or ParC subunits [ 13 , 14 ]. The broad-spectrum activity of quinolones against various infections and the widespread use of these antibiotics, the abuse and unnecessary use of them, especially in developing countries, has accelerated the development of resistance mechanisms [ 15 ].
Fluoroquinolones are used in the treatment of infectious diseases, including coliform mastitis caused by E. coli. Since the drug resistance pattern has regional distribution, determination of this pattern of E. coli resistance can be used to determine the appropriate treatment regimen for clinical coliform mastitis [ 16 ]. This study aimed to determine the resistance pattern of E. coli isolated from cows with coliform mastitis to some fluoroquinolones and also to detect the mutations in QRDR of fluoroquinolone-resistance E. coli isolates.
Results
Identification of E. coli
In this study, 100 milk samples were subjected to isolation of E. coli by selective plating followed by streaking on the Eosin Methylene Blue (EMB) agar at 37 ˚C for 24 h. Typical colonies of E. coli were produced from 45 samples. These 45 presumptive E. coli isolates on EMB agar were confirmed by biochemical tests (Figure 1).
Susceptibility testing
The results of susceptibility study showed that less than 20% of E. coli isolates had intermediate resistance to each antibiotic (Figure 2). Intermediate resistance was 3.33% to ciprofloxacin and levofloxacin, 15% to enrofloxacin and norfloxacin, and 16.7% to ofloxacin (Table 1).
Antibiotic (μg) | No. of sensitive isolates | % sensitive isoates | % intermediate resistant isolates | % resistant isolates |
---|---|---|---|---|
Ofloxacin (5) | 50 | 83.3 | 16.7 | - |
Enrofloxacin (5) | 51 | 85 | 15 | - |
Norfloxacin (10) | 51 | 85 | 15 | - |
Ciprofloxacin (5) | 58 | 96.6 | 3.33 | - |
Levofloxacin (5) | 58 | 96.6 | 3.33 | - |
Identification of gyrA and parC mutations in clinical isolates of E. coli
Amplification of the QRDRs of gyrA and parC genes was performed by PCR (Figure 3). The results of the DNA sequencing of gyrA and those of parC were consistent and provided information from both standards for a region between nucleotides 247 to 840 (corresponding to codons 82 to 280) of gyrA and from nucleotides 167 to 539 (corresponding to codons 55 to 180) of the parC gene, respectively (Table 2, Figures 4, 5, 6, and 7). Accession numbers of E. coli isolates based on QRDRs of gyrA and parC genes deposited in the GenBank are as follows: SRX5988183, SRX5982112 for sample number 2968, and SRR17711097, SRR17711096 for sample number 3077 (Accession to cite for these SRA data: PRJNA547542).
E. coli isolate | gyrA mutation | parC mutation | ||||
---|---|---|---|---|---|---|
Codon position | Nucleotide exchange | Amino acid exchange | Codon position | Nucleotide exchange | Amino acid exchange | |
2968 | 91 | CGT → CGC | ginine a | 91 | CAG → CAA | Glutamine a |
100 | TAC → TAT | Tyrosine a | 157 | CTG → CTA | Leucine a | |
111 | TCC → TCT | Serine a | 159 | GCT → GCC | Alanine a | |
131 | GCA → GCC | Alanine a | ||||
132 | AAT → CAT | Asparagine → Histidine | ||||
3077 | 65 | AAT → CAT | Asparagine → Histidine | 195 | GGT → GTT | Glycine → Valine |
80 | GCA → TCA | Alanine → Serine | 209 | GTG → TTA | Valine → Leucine | |
83 | AGG → GGG | Arginine → Glycine | 212 | GGC → CAC | Glycine → Histidine | |
a Silent mutation |
Discussion
The focus of the current study was to assess the resistance of E. coli to some fluoroquinolones in bovine coliform mastitis and to generate the fluoroquinolones resistance profile of isolates. The level of resistance of E. coli isolates to enrofloxacin and norfloxacin was similar to the level of resistance to ofloxacin. This is due to the development of cross-resistance to one of the fluoroquinolones. In the present study, among all 60 E. coli isolates, less than 20% of isolates had intermediate resistance to fluoroquinolones. This is still a relatively low figure compared with other published studies, in which the proportion of resistant isolates has ranged from 23% to 63% [ 15 , 17 - 19 ]. In the results from Su et al. (2016) E. coli isolates showed 4% resistance to ciprofloxacin and levofloxacin; similarly, E. coli isolates in th e present study showed only 3.33% resistance to ciprofloxacin and levofloxacin whereas Metzger and Hogan (2013) found 12% of E. coli isolated from bovine milk samples were non-susceptible to ciprofloxacin [ 20 , 21 ]. Among fluoroquinolones, enrofloxacin and norfloxacin resistance were found in nine (15%) E. coli isolates, and all other isolates were susceptible to norfloxacin and enrofloxacin.
This is in general agreement with Malinowski et al. (2008) who found that 16.1% and 14.9% mastitis E. coli isolates from Poland were resistant to enrofloxacin and norfloxacin, respectively [ 22 ]. However, in a study in Bangladesh, no resistance to fluoroquinolones including ofloxacin, ciprofloxacin, and levofloxacin was reported in E. coli isolated from milk of mastitis cattle [ 23 ]. Persson et al. (2011) reported that there was no fluoroquinolone resistance in E. coli isolated from milk samples of cows with mastitis [ 24 ]. In another study by Persson and her colleagues in Sweden (2015), they reported that all isolates (n=57) of E. coli from dairy cows with acute clinical mastitis were susceptible to enrofloxacin [ 25 ]. Armanullah et al. (2018), studied the antibiotic resistance profile of E. coli isolates from bovine clinical mastitis and reported resistance to ciprofloxacin (16.67%), norfloxacin (8.33%), ofloxacin (8.33%), and intermediate resistance to norfloxacin (8.33%) that was somewhat similar to the finding of the present study [ 26 ].
Fluoroquinolone resistance of E. coli isolates from bovine mastitis has been studied by several authors and the results have varied, which may be due to different methods and breakpoints used to determine susceptibility. Resistance to fluoroquinolones is still uncommon among E. coli isolated from bovine mastitis. In comparison to other studies [ 15 , 17 - 19 , 27 ], the results of this study showed a low level of resistance to fluoroquinolones, which may be due to the controlled use of these antibiotics. However, in the present study ciprofloxacin and levofloxacin were proved to be the best antibiotics to treat E. coli mastitis in cattle since they were highly effective.
In the present study, the E. coli isolates did not have resistance to fluoroquinolones and the rate of intermediate resistance to fluoroquinolones was very low. It is generally accepted that gyrA mutations play a major role in the development of fluoroquinolone resistance in E. coli, while the mutations in the parC gene are additionally associated with resistance [ 28 ]. To analyze the correlation between genetic characterization and resistance phenotype, two isolates with the most resistance to each fluoroquinolone were submitted to amplification and sequencing of the QRDR in gyrA and parC genes. There were two silent mutations in the gyrA gene at wobble position in codons 91 and 100; similarly, E. coli isolates in the Heisig study showed silent mutations in codons 91 and 100 [ 28 ]. Mutation at codons 83 and 87 was found to be the most common gyrA mutations of E. coli in several studies, and in the present study, there was a mutation in codon 83 of gyrA in sample number 3077 [ 29 - 32 ]. In addition, we found a silent mutation in codon 91 in the parC gene. Similarly, E. coli isolates in the Heisig study showed silent mutation only in codon 91, whereas the most common mutations in parC were reported at codons 80, 84, and 87 [ 19 , 28 , 31 , 32 ].
In conclusion, the current investigation showed that most E. coli isolates isolated from raw milk of cows with coliform mastitis in Khorasan Razavi province were sensitive to fluoroquinolones and some E. coli isolates had intermediate resistance to fluoroquinolones. In gyrA and parC genes of E. coli isolates with the most intermediate resistance to studied fluoroquinolones, there were silent mutations and mutations. There is some evidence that silent mutations can especially affect the regulation of transcription [ 33 - 35 ].
Sample collection
A total of one hundred (100) milk samples were examined in this study. Samples were collected from the milk of dairy cattle with clinical mastitis of three dairy farms in Mashhad (Khorasan Razavi province, Iran). Fifteen isolates of E. coli were obtained from “Bacterial Collection of the Mastitis Laboratory”, Veterinary Teaching Hospital, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad.
Isolation of E. coli
Milk samples were cultured on MacConkey agar media (Merk, Darmstadt, Germany) and were incubated at 37 ˚C for 24 h. Suspected E. coli lactose-fermenting colonies (pink colonies) were used for culture on the Eosin methylene blue (EMB) agar (Merk, Darmstadt, Germany). The appearance of the colonies of purple with black center and green metallic sheen were considered positive for E. coli on EMB agar and were selected for further studies. The colonies of presumptive E. coli on EMB agar were confirmed by standard biochemical tests, including triple sugar iron agar, Simmons citrate agar, and motility assay.
Antibiotic susceptibility study
Antibiotic susceptibility testing was carried out with equivalence of 0.5 McFarland turbidity standard by agar disk diffusion method on Mueller-Hinton agar (Himedia, Mumbai, India) plates following the Clinical and Laboratory Standards Institute [ 36 ]. All E. coli isolates were subjected to an antibiotic susceptibility test. The antimicrobial disks (Padtan Teb, Tehran, Iran) used in the experiment included 5 μg ciprofloxacin, 10 μg norfloxacin, 5 μg levofloxacin, 5 μg ofloxacin, and 5 μg enrofloxacin. The antibiotic disks were placed on Mueller-Hinton agar culture plate. The plates were incubated for 18-24 h at 37 ˚C. The size of the zone of inhibition was recorded and resistance zone diameter breakpoints adopted for these antimicrobials were the following: ≤ 15 mm for ciprofloxacin, ≤ 12 mm for norfloxacin, ≤ 13 mm for levofloxacin, ≤ 12 mm for ofloxacin, and ≤ 14 mm for enrofloxacin.
DNA extraction
E. coli isolates were grown overnight in Nutrient agar (Merk, Darmstadt, Germany) at 37 ˚C. One colony was suspended in 250 µL of sterile distilled water. After boiling the suspension for 15 min, followed by freezing and subsequent centrifugation at 14000 rpm for 15 min, the cell debris was pelleted and the supernatant was used as a template for the amplification reaction. [ 37 ]
Amplification of quinolone resistance determining regions (QRDRs)
Polymerase chain reaction (PCR) was used to amplify QRDR of gyrA and parC for mutation detection. The list of primers that were used for amplification of gyrA and parC genes is shown in Table 3. The PCR amplification was performed in a total reaction volume of 25 µL. The reaction mixture contained 12.5 µL of 2x master mixtures (CinnaGen, Tehran, Iran), 1 µL of each forward and reverse primer (10 pmol/µL), 8.5 µL of deionized water and 2 µL of DNA template. The PCR program included initial denaturation at 94 ˚C for 5 min followed by 30 cycles of denaturation (94 ˚C for 1 min), annealing (55 ˚C for gyrA and 56 ˚C for parC for 1 min), and extension (72 ˚C for 1 min) with a final extension at 72 ˚C for 5 min. For amplification of DNA, the PCR was performed with a thermocycler (Techne, Chelmsford, UK). The PCR products were run on a 1% agarose gel in TAE buffer at 100 V for 45 min. After electrophoresis (Padideh Nojen Pars, Mashhad, Iran) in the agarose gel and staining with the green viewer (Sinaclone, Tehran, Iran), they were observed and documented under gel documentation system (Kimiagene, Mashhad, Iran). A 100 bp plus DNA ladder was used to determine the molecular size of the PCR products. Primers used in the study were custom synthesized from Macrogen Inc. (South Korea).
Primer name | Primer direction a | Sequence (5' to 3') | Product size (bp) | Annealing temperature (°C) | Refer-ence | |
---|---|---|---|---|---|---|
gyrA4 | F | TCGTTGGTGACGTAATCGGT | 253 | 55 | [ 31 ] | |
gyrA5 | R | TCCGTGCCGTCATAGTTATC | 253 | 55 | [ 31 ] | |
parC1 | F | AACCTGTTCAGCGCCGCATT | 434 | 56 | [ 31 ] | |
parC2 | R | ATGCGGTGGAATATCGGTCG | 434 | 56 | [ 31 ] | |
a F, forward; R, reverse |
Sequencing and Alignment
The PCR product of gyrA and parC genes with forward and reverse primers sent for sequencing to Microsynth (Switzerland). DNA sequences were analysed using Chromas software. DNA sequence data were compared to data in the GenBank database using the BLAST algorithm available at the National Center for Biotechnology Information (NCBI) website (www.ncbi.nlm.nih.gov).
Acknowledgement
We wish to thank H.K. Rahmani, A. Kargar and N. Shahbazi for their technical assistance. This research was financially supported by Ferdowsi University of Mashhad. Mashhad, Iran.
Conflict of interest
The authors declare that they have no competing interests.
References
- Janzen J. Economic losses resulting from mastitis. A review. J Dairy Sci. 1970; 53(9):1151-60.
- Jingar SC, Mahendra S, Roy AK. Economic losses due to clinical mastitis in cross-bred cows. Dairy Vet Sci J. 2017; 3(2):555606.
- Hogan J, Smith KL. Coliform mastitis. Vet Res. 2003; 34(5):507-19.
- Cullor JS, Smith WL. Endotoxin and disease in food animals. Compend. Contin. Educ. Vet. 1996; 18(1): 31-38.
- Bradely AJ, Leach KA, Breen JE, Green LE, Green MJ. Survey of the incidence and etiology of mastitis in dairy farms in England and Wales. Vet Rec. 2007; 160:253-258.
- Wenz JR, Barrington GM, Garry FB, Dinsmore RP, Callan RJ. Use of systemic disease signs to assess disease severity in dairy cows with acute coliform mastitis. J Am Vet Med Assoc. 2001; 218(4):567-72.
- Burvenich C, Van Merris V, Mehrzad J, Diez-Fraile A, Duchaeau L. Severity of E. coli mastitis is mainly determined by cow factors. Vet Res. 2003; 34:521-564.
- Suojala L, Kaartinen L, Pyörälä S. Treatment for bovine Escherichia coli mastitis – an evidence based approach. J Vet Pharmacol Ther. 2013; 36(6):521-31.
- Sharfaraj Nawaz M, Bodla R, Kant R, Pratab Singh S, Bhutani R, Kapoor G. Fluoroquinolone as antimicrobial agent: A Review. Int J Pharm Sci Res. 2017; 2(3):57-63.
- Suh B, Lorber B. Quinolones. Med Clin North Am. 1995; 79(4):869-894.
- Hooper DC. Mechanisms of action of antimicrobials: focus on fluoroquinolones. Clin. Infect. Dis. 2001; 32(1): 9-15.
- Higgins PG, Fluit AC, Schmitz FJ. Fluoroquinolones: structure and target sites. Curr. Drug. Targets. 2003; 4(2): 181-190.
- Hooper DC. Mechanisms of quinolone resistance. In: Hooper DC, Rubinstein E (Eds.), Quinolone antimicrobial agents. (3rd Edn.), Washington, D.C, USA: American Society of Microbiology Press. 2003; PP:41-67.
- Hopkins KL, Davies RH, Threlfall EJ. Mechanisms of quinolone resistance in Escherichia coli and Salmonella: recent developments. Int J Antimicrobial Agents. 2005; 25:358-373.
- Saranya K, Pavulraj S, Kalaiselvi L, Amsaveni S, Ramesh S. Antibacterial susceptibility profiles of coliforms isolated from bovine subclinical and clinical mastitis against fluoroquinolones.Tamilandu Journal. Vet Anim Sci. 2013; 9 (4):279-284.
- Srinivasan V, Gillespie BE, Lewis MJ, Nguyen LT, Headrick SI, Schukken YH, Oliver SP. Phenotypic and genotypic antimicrobial resistance patterns of Escherichia coli isolated from dairy cows with mastitis. Vet. Microbiol. 2007; 124(3-4): 319-328.
- Alekish M, Al-Qudah K, Al-Saleh A. Prevalence of antimicrobial resistance among bacterial pathogens isolated from bovine mastitis in northern Jordan. Rev Vet Med. 2013; 164:319-26.
- Chandrasekaran D, Venkatesan P, Tirumurugaan K, Nambi A, Thirunavukkarasu P, Kumanan K, et al. Pattern of antibiotic resistant mastitis in dairy cows. Vet World. 2014; 7(6):389-394.
- Balakrishnan S, Antony PX, Mukhopadhyay HK, Pillai RM, Thanislass J, Padmanaban V, et al. Genetic characterization of fluoroquinolone-resistant Escherichia coli associated with bovine mastitis in India. Vet World. 2016; 9(7):705-709.
- Su Y, Yu C-Y, Tsai Y, Wang S-H, Lee C, Chu C. Fluoroquinolone-resistant and extended-spectrum β-lactamase-producing Escherichia coli from the milk of cows with clinical mastitis in Southern Taiwan. J Microbiol Immunol Infect. 2016; 49(6):892-901.
- Metzger SA, Hogan JS. Short communication: Antimicrobial susceptibility and frequency of resistance genes in Escherichia coli isolated from bovine mastitis. J Dairy Sci. 2013; 96:3044-3049.
- Malinowski E, Lassa H, Smulski S, Kłossowska A, Kaczmarowski M. Antimicrobial susceptibility of bacteria isolated from cows with mastitis in 2006-2007. Bulletin of the Veterinary Institute in Pulawy. 2008; 52(565):72.
- Tanzin T, Nazir KHMNH, Zahan MN, Md. Parvej S, Zesmin K, Rahman MT. Antibiotic resistance profile of bacteria isolated from raw milk samples of cattle and buffaloes. J Adv Vet Anim Res. 2016; 3 (1): 62-67.
- Persson Y, Nyman AK, Grönlund-Andersson U. Etiology and antimicrobial susceptibility of udder pathogens from cases of subclinical mastitis in dairy cows in Sweden. Acta Vet Scand. 2011; 53(1):36.
- Persson Y, Katholm J, Landin H, Mörk Mj. Efficacy of enrofloxacin for the treatment of acute clinical mastitis caused by Escherichia coli in dairy cows. Vet Rec. 2015; 176(26):673-673.
- Armanullah MD, Anjay Dr, Kumar P, Kumari S, Kaushik P, Archana S, Arya S. Prevalence of Multi-Drug Resistant (MDR) Escherichia coli in bovine clinical samples. Int. J. Curr. Microbiol. App. Sci. 2018; 7: 1476-1485.
- Firouzi R, Rajaian H, Tabaee I, Saeedzadeh A. In vitro antibacterial effects of marbofloxacin on microorganisms causing mastitis in cows. J Vet Res. 2010; 65(1):51-55.
- Heisig P. Genetic evidence for a role of parC mutations in development of high-level fluoroquinolone resistance in Escherichia coli. Antimicrob. Agents Chemother. 1996; 40(4): 879-85.
- Chen JY, Siu LK, Chen YH, Lu PL, Ho M, Perg CF. Molecular epidemiology and mutations at gyrA and parC genes of ciprofloxacin-resistant Escherichia coli isolates from Taiwan medical center. Microb Drug Resist. 2001; 7:47-53.
- Ruiz J, Gomez J, Navia MM, Ribera A, Sierra JM, Marco F. High prevalence of nalidixic acid resistant, ciprofloxacin susceptible phenotype among clinical isolates of Escherichia coli and other Enterobacteriaceae. Diagn Microbiol and infect Dis. 2002; 42:257-61.
- Ogbolu DO, Daini O, Ogunledun A, Alli AT, Olusoga-Ogbolu F, Webber M. Effects of gyrA and parC mutations in quinolones resistant clinical gram negative bacteria from Nigeria. Afr J Biomed Res. 2012; 15(2):97-104.
- Sáenz Y, Zarazaga M, Briñas L, Ruiz-Larrea F, Torres C. Mutations in gyrA and parC genes in nalidixic acid-resistant Escherichia coli strains from food products, humans and animals. J Antimicrob Chemother. 2003; 51(4):1001-5.
- Yadegari H, Biswas A, Akhter MS, Driesen J, Ivaskevicius V, Marquardt N, Oldenburg J. Intron retention resulting from a silent mutation in the VWF gene that structurally influences the 5' splice site. Blood. 2016; 128(17):2144-2152.
- Agashe D, Sane M, Phalnikar K, Diwan GD, Habibullah A, Martinez-Gomez NC, et al. Large-effect beneficial synonymous mutations mediate rapid and parallel adaptation in a bacterium. Mol Biol Evol. 2016; 33(6):1542-53.
- Hauber DJ, Grogan DW, DeBry RW. Mutations to less-preferred synonymous codons in a highly expressed gene of Escherichia coli: fitness and epistatic interactions. PLoS One. 2016; 11(1):e0146375.
- CLSI. Performance standards for antimicrobial susceptibility testing. 27th ed. CLSI supplement M100. Clinical and Laboratory Standards Institute: Wayne, PA; 2017.
- Reischl U, Youssef MT, Kilwinski J, Lehn N, Zhang WL, Karch H, et al. Real-time fluorescence PCR assay for detection and characterization of shiga toxin, intimin, and enterohemolysin genes from shiga toxin-producing Escherichia coli. J Clin Microbiol. 2007; 40(7):2555-2565.
Send comment about this article