Prevalence of Chlamydia abortus Infection in Aborted Sheep and Goats in Kerman Province, Southeast of Iran

Document Type : Research Article

Authors

1 Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman, Iran.

2 Department of Basic sciences, Faculty of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman, Iran

Abstract

In recent years, C. abortus, the etiological agent of ovine enzootic abortion, has been associated with many cases of lamb loss in sheep and goat farms in Iran. However, there is a lack of epidemiological data regarding Chlamydia-related abortion in this region. Accordingly, we aimed to investigate the prevalence of C. abortus and the associated risk factors in the small ruminants of Kerman Province, southeast Iran. For this purpose, we collected 134 vaginal swab samples from 70 sheep and 64 goats that had experienced abortion. Following DNA extraction from samples, we amplified the POMP90-3 gene of C. abortus using PCR to confirm C. abortus presence, and then one positive sample was selected for sequencing. The results indicated an overall C. abortus prevalence rate of 21.6%, with 20.3% prevalence in goats and 22.8% in sheep. We observed a higher incidence rate in animals with a higher number of parturition; however, no significant corelation was observed between the prevalence rate of C. abortus and species.  In addition, sampling location was considered a risk factor associated with C. abortus infection. This study highlighted C. abortus as a threat to small ruminants' reproduction in Kerman Province, which deserves constant monitoring and multi-faceted preventive strategies.

Keywords

Main Subjects

Abbreviations

C. abortus: Chlamydia abortus

MOMP: Major outer membrane proteins

POMP: Polymorphic outer membrane proteins

PBS: Phosphate-buffered saline

PCR: Polymerase chain reaction

OEA: Ovine enzootic abortion

Introduction

C.abortus, a Gram-negative bacterium belonging to the family Chlamydiaceae, is an obligate intracellular pathogen responsible for OEA or EAE. The disease burdens considerable economic loss in small ruminant farms if it affects enormous cases called abortion storms [ 1 - 4 ]. C. abortus transmits through any environmental exposure to the bacteria released by infected animals, abortion materials, or post-partum secretions, which poses health concerns for pregnant women and wild animals [ 5 , 6 ]. Spillover of C. abortus through domestic and wild animal reservoirs has made controlling the disease difficult [ 5 ].

In the initial stage of C. abortus infection, bacteria colonize in the lymphatic tissues and then disseminate to other organs, resulting in several implications, such as pregnancy loss (abortion) and birth to stillborn if the infection occurred in the late stage of pregnancy (5-6 months) [ 3 , 7 - 9 ]. Otherwise, bacteria enter the latency phase and may cause abortion in the second year of pregnancy [ 10 ]. Various approaches are available for confirming C. abortus in diagnostic laboratories. Methods for the direct identification of the agent, such as C. abortus isolation from clinical samples, staining the smears of fecal samples or vaginal swabs, and immunological staining of the organism, are either outdated or non-convenient [ 11 - 15 ]. Serological tests, including CFT and ELISA, are used for the indirect diagnosis of C. abortus [ 16 ]. These techniques identify the presence of chlamydial antibodies in the sera of infected animals. However, they have been replaced with molecular methods to improve the detection of C. abortus. Molecular identification methods, such as PCR, real-time PCR, and DNA microarray are highly sensitive approaches due to targeting different biomarker sequences, namely conserved regions, MOMP, POMP genes, or the intergenic space between the 16S and 23S rRNA genes [ 17 - 20 ].

Although C. abortus distributes worldwide, the reported distribution of C. abortus is far from the true infection prevalence [ 5 ] because of the variability in the sensitivity and specificity of the diagnostic tests and a lack of C. abortus epidemiological information, especially in developing countries in Asia and Africa [ 21 ]. OEA is endemic in Iran, and several studies previously reported the incidence of the disease in sheep and goats in some areas of this country [ 22 - 25 ]. In the present study, we attempted to investigate the prevalence rate and associated predisposing factors of C. abortus infection in aborted sheep and goats of Kerman Province in Iran to provide valuable insight into bacteria spillover in this region.

Results

Identification of C. abortus

Among 134 vaginal swabs collected from sheep and goats, 16 sheep (22.8%) and 13 goats (20.3%) were confirmed to be positive for C. abortus based on the amplification of the POMP 90-3 gene (220 bp) in PCR (Figure 1). The PCR results were validated by sequencing and blasting one PCR product, which showed the highest similarity with the POMP 90-3 gene of C. abortus that was previously registered on NCBI under the accession number ACD10929.1.

Figure 1. The agarose gel electrophoresis of the POMP 90-3 gene of C. abortus isolates. M: 100 bp ladder; N: negative control (distilled water); P: positive control (C. abortus); lanes 1-17: test samples. The observation of a 220 bp band in a sample confirmed C. abortus presence.

Prevalence of C. abortus infection

The prevalence rate of chlamydiosis based on different variables, such as animal species, age, number of parturition, and the location was statistically analyzed in the aborted flocks of sheep and goats using the Chi-squared test (Table 1). According to the results, the prevalence of C. abortus varied in the different regions ranging from 0% in Bam city to 28.3% in Baft city. Our findings revealed a significant correlation between the geographical area and the level of C. abortus in flocks (p = 0.03). There was no significant relationship between C. abortus infection and animal species (sheep and goats) (p = 0.7), or the age of infected animals (p = 0.2). However, the number of abortions in infected animals had a significant correlation with parity (p = 0.001).

Variables No. Number of positive samples Prevalence (%) p-value
Animal species:
Sheep 70 16 22.8 0.7b
Goat 64 13 20.3
Total 134 29 21.6
Number of parturition:
< 2 59 4 6.7 0.001a
2 – 4 40 10 25
> 4 35 15 42
Age (yr):
< 2 45 12 26.6 0.2b
2 – 4 50 7 14
> 4 39 10 25.6
City:
Baaft 60 17 28.3 0.03a
Bam 10 0 0
Bardsir 25 4 16
Kerman 14 2 14.2
Shahr-e Babak 25 6 24
a: significant difference (P < 0.05)
b: insignificant (P > 0.05)
 Table 1.Prevalence rate of C. abortus in sheep and goats from different regions of Kerman Province, Iran

Discussion

OEA is an infectious disease with clinical demonstrations in small ruminants, such as sheep and goats [ 11 ]. Due to massive economic loss, chlamydial abortion is a global concern in agricultural industries in Europe, North America, Africa, and Iran [ 21 ]. There are various laboratory diagnostic techniques for surveying the epidemiology of the disease, such as serological tests and basic detection methods, which provide less sensitivity and specificity for the confirmation of microorganisms. However, molecular methods based on outlining specific genes can reliably identify and differentiate the chlamydial species [ 17 ].

In the present study, we identified a high incidence rate of C. abortus infection in the Kerman Province of Iran, with ranges of 20.3% and 22.8% in goats and sheep, respectively. The results indicated that various factors, such as geographical location and the number of parturitions, could influence C. abortus infection. This observation also highlighted the need for constant genetic and antigenic evaluation of abortion isolates to establish national strategies for preventing the transmission of C. abortus in the future.

The prevalence rate of C. abortus infection in small ruminants depends on many factors, including the geographical location, size and type of samples taken, animal breed, grazing and management strategies, nutritional deficiency, uncontrolled restriction of a diseased animal movement from infected areas, choice of diagnostic antigen, and studding method [ 18 ]. Moreover, aging, species, gender, number of parturition, and geographical region are reported as effective factors in the prevalence of C. abortus [ 25 ]. Most investigations on the prevalence of OEA in sheep and goats reported an average rate of 20%-37% in Iran [ 22 - 25 ]. In this regard, a survey showed a twice higher prevalence in Chaharmahal and Bakhtiari province. However, some other studies reported a low prevalence of 9% in the south to 11% in the northeast of Iran [ 26 - 28 ]. In neighboring countries, such as Iraq, Arif et al. recorded chlamydiosis in only one of the 30 samples from the aborted ewes (3.3%) in Sulaimani province, which is far from the rate commonly reported in Iran [ 18 ]. In the current study, we observed an overall C. abortus prevalence of 21.6% among the small ruminants of Kerman province, which was in agreement with most available data in Iran. We also detected diverse incidence rates in different cities, which is consistence with the sero-prevalence of C. abortus in the countries of origin Jordan [ 29 ] and China [ 30 ]. In contrast with our study, the incidence rate of C. abortus infection showed no difference among populations located in different epidemiologic areas of Khorasan Razavi province, northeast of Iran [ 28 ]. Another research in the southwest of Iran also showed that the geographical origin of sheep had no significant effect on the incidence of C. abortus [ 31 ].

Our findings showed that chlamydial infection incidence was higher in ewes with a higher number of parturition. Other studies also reported similar results in Iran and Jordan [ 25 , 29 ]. The establishment of the latent form of C. abortus pathogenesis in non-pregnant infected ewes and the bacteria reactivation and proliferation in the subsequent pregnancy might be the reason for the higher prevalence of infection in ewes with a higher parity [ 9 ].

According to Table 1, the age of animals is not a predisposing factor for C. abortus prevalence. In agreement with this result, Iraninezhad et al. [ 28 ] and Cubero et al. [ 32 ] recorded no significant correlation between age and the epidemiology of chlamydial infection. Contrary to our study, a positive relationship between the age of aborted animals and the chance of positivity for C. abortus was mentioned in other reports [ 25 , 30 ].

According to our results, although the chlamydial infection rate was higher in sheep than in goats, this difference was not significant (Table 1). Similarly, previous studies showed that species was not a risk factor for the occurrence of chlamydial infection [ 23 , 25 , 28 , 30 , 33 ]. In this regard, a difference was reported by other researchers in the infection incidence between sheep and goats [ 34 - 36 ]. For example, a higher rate of chlamydial infection was observed in sheep compared to goats in Taiwan [ 37 ].

Conclusion

This study was the first report on the prevalence of C. abortus infection among goats and sheep in Kerman province of Iran. According to PCR results, C. abortus was responsible for 22.8% and 20.3% of abortion incidence in sheep and goats, respectively. This finding indicates the circulation of C. abortus among small ruminants in Kerman province, which poses serious public health concerns.

Materials and Methods

Sample collection

During the lambing season of 2022, 134 vaginal swab samples were collected from 70 sheep and 64 goats with a history of abortion in different cities of Kerman province in the southeast of Iran. The samples were suspended in 500 µl of sterile PBS and then transferred on ice to the Microbiology Laboratory at the Faculty of Veterinary Medicine of the Shahid Bahonar University of Kerman. The samples were stored at -20°C for DNA extraction.

DNA extraction

The DNA was extracted from vaginal samples using DNA extraction commercial kit (Cinaclon, Iran) according to the manufacturer’s instructions. The extracted DNA was quantified by a NanoDrop spectrophotometer (Epoch, BioTek Instruments Inc., USA) at the wavelength of 260 nm, and stored at -20˚C for further analysis.

PCR verification

To detect C. abortus, PCR was performed on the extracted DNA to amplify the POMP 90-3 gene with specific primers (F:5'–TTTTCAGGATCCTATTGTCCTCCAGGCA–3' and R:5'–GTGAATTCATCAGCATAAATAGCCCCG–3') [ 14 ]. The PCR reaction mix was prepared at a final volume of 20 µl, including 10 µl master mix (Amplicon, Denmark), 4 µl template DNA, 0.5 µl of each forward and reverse primer, and 5 µl distilled water. The amplification was initiated with 3 min of denaturation at 95°C, followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 60°C for 30 seconds, extension at 72°C for 1 min, and a final extension at 72°C for 10 min. the PCR amplicons were visualized by agarose gel electrophoresis 1.5% and exposed to a UV light to detect the POMP 90-3 gene (220 bp).

POMP 90-3 gene sequencing

In the next step, the PCR product of one Chlamydia-positive sample was subjected to sequencing (Macrogen Inc., South Korea) to confirm the amplified POMP 90-3 gene. After receiving DNA fragments of the POMP 90-3 gene, they were trimmed and then assembled using DNAstar software. The final consensus of the received sequence was compared to any relevant sequence in the NCBI database using BLAST.

Statistical analysis

The sample size was calculated using the online software https://www.calculator.net/sample-size-calculator.html, with a confidence level of 95% and desired absolute precision of 10%. The SPSS for Windows (version 25.0; IBM Corp., Armonk, USA) was applied to perform statistical analysis. The rate of abortion between the investigated groups was explained as percentage of all the sampled animals. The effect of independent risk factors, such as sampling location, number of parturition, animal species, and age on the prevalence of C. abortus infection was analyzed by Chi-squared test. The differences in prevalence were considered significant at p < 0.05.

Authors' Contributions

S.A. collected samples, carried out the analysis of samples, data analysis, and wrote the manuscript. M.G. designed the study, supervised the project, revised the data analysis, and critically revised all parts of the manuscript. E.M. supervised the laboratory works. N.E. formal analysis, writing—review and editing. M.A.S. formal analysis, writing—review and editing.

Acknowledgements

Thanks to everyone who helped us in the current study.

Competing Interests

The authors declare that there is no conflict of interest.

References

  1. Givens MD, Marley MSD. Infectious causes of embryonic and fetal mortality. Theriogenolog. 2008; 70: 270-285. DOI
  2. Stephens RS (ed.). Chlamydia: intracellular biology, pathogenesis, and immunity. ASM, Washington, D.C. 1999.
  3. Longbottom D, Coulter LJ. Animal chlamydioses and zoonotic implications. Journal of Comparative Pathology. 2003. DOI
  4. Sachse K, Hotzel H, Slickers P, Ellinger T, Ehricht R. DNA microarray-based detection and identification of Chlamydia and Chlamydophila spp. Molecular and Cellular Probes. 2005; 19(1):41-50. DOI
  5. Turin L, Surini S, Wheelhouse N, Rocchi MS. Recent advances and public health implications for environmental exposure to Chlamydia abortus: from enzootic to zoonotic disease. Veterinary Research. 2022 Dec; 53 (1):1-7. DOI
  6. Selim A. Chlamydophila abortus Infection in Small Ruminants: A Review. Asian Journal of Animal and Veterinary Advances. 2016; 11(10):587-93. DOI
  7. Papp JR, Shewen PE, Gartley CJ. Abortion and subsequent excretion of chlamydiae from the reproductive tract of sheep during estrus. Infection and Immunity. 1994; 62(9): 3786-3792. DOI
  8. Osman KM, Ali HA, ElJakee JA, Galal HM. Chlamydophila psittaci and Chlamydophila pecorum infections in goats and sheep in Egypt. Revue scientifique et technique. 2011; 30:939-948. DOI
  9. Longbottom D, Livingstone M, Maley S, van der Zon A, Rocchi M, Wilson K, et al. Intranasal infection with Chlamydia abortus induces dose-dependent latency and abortion in sheep. PloS one. 2013; 8(2):e57950. DOI
  10. Buxton D, Anderson IE, Longbottom D, Livingstone M, Wattegedera S, Entrican G. Ovine chlamydial abortion: characterization of the inflammatory immune response in placental tissues. Journal of Comparative Pathology. 2002; 127(2-3):133-141. DOI
  11. Rodolakis A, Salinas J, Papp J. Recent advances on ovine Chlamydial abortion. Veterinary Research. 1998; 29((3-4)):275-88. PubMed
  12. Livingstone M, Wheelhouse N, Maley SW, Longbottom D. Molecular detection of Chlamydophila abortus in post-abortion sheep at oestrus and subsequent lambing. Veterinary Microbiology. 2009; 135:134-141. DOI
  13. Poppert S, Essig A, Marre R, Wagner M, Horn M. Detection and differentiation of chlamydiae by fluorescence in situ hybridization. Applied and Environmental Microbiology. 2002; 68(8):4081-4089. DOI
  14. Vanrompay D, Geens T, Desplanques A, Hoang TQ, De Vos L, Van Loock M, et al. Immunoblotting, ELISA and culture evidence for Chlamydiaceae in sows on 258 Belgian farms. Veterinary Microbiology. 2004; 99(1):59-66. DOI
  15. Longbottom D, Fairley S, Chapman S, Psarrou E, Vretou E, Livingstone M. Serological diagnosis of ovine enzootic abortion by enzyme-linked immunosorbent assay with a recombinant protein fragment of the polymorphic outer membrane protein POMP90 of Chlamydophila abortus. Journal of Clinical Microbiology. 2002; 40(11):4235-4243. DOI
  16. Clarkson MJ, Philips HL. Isolation of faecal chlamydia from sheep in Britain and their characterization by cultural properties. Journal of Veterinary Medicine. 1997; 153(3):307-310. DOI
  17. Sachse K, Vretou E, Livingstone M, Borel N, Pospischil A, Longbottom D. Recent developments in the laboratory diagnosis of chlamydial infections. Veterinary Microbiology. 2009; 135(1-2):2-21. DOI
  18. Arif ED, Saeed NM, Rachid SK. Isolation and Identification of from Aborted Ewes in Sulaimani Province Northern Iraq. Polish Journal of Microbiology. 2020; 69(1): 65-71. DOI
  19. Everett KD, Andersen AA. Identification of nine species of the Chlamydiaceae using PCR-RFLP. International Journal of Systematic and Evolutionary Microbiology. 1999; 49(2):803-813. DOI
  20. Laroucau K, Souriau A, Rodolakis A. Improved sensitivity of PCR for Chlamydophila using pmp genes. Veterinary Microbiology. 2001; 82(2):155-164. DOI
  21. Borel N, Thoma R, Spaeni P, Weilenmann R, Teankum K, Brugnera E, et al. Chlamydia-related abortions in cattle from Graubunden, Switzerland. Veterinary Pathology. 2006; 43(5): 702-708. DOI
  22. Ebadi A, Moosakhani F, Jamshidian M. Phylogenetic analysis of Chlamydia abortus isolated from fetus aborted ewes of Alborz Province. Bulletin of Environment, Pharmacology and Life Sciences. 2014; 4:122-126.
  23. Esmaeili H, Bolourchi M, Mokhber-Dezfouli MR. Seroprevalence of Chlamydia abortus infection in sheep and goats in Iran. Iranian Journal of Veterinary Medicine. 2015; 9(2):73-77. DOI
  24. Esmaeili H, Hamedi M, Madani SA. Isolation of Chlamydia spp. from Ewes and Does in Iran. Archives of Razi Institute. 2017; 72(4):249-253. DOI
  25. Hamedi M, Esmaeili H, Madani SA, Tajik P. The Frequency of Abortion Caused by Chlamydia abortus in Aborted Fetuses of Sheep and Goats in Iran. Journal of Medical Bacteriology. 2020; 9(1-2):1-8.
  26. Mahzounieh M, Pourahmad R. Detection of Chlamydophila abortus in sheep abortions in Chaharmahal va Bakhtiari Province using Nested PCR. Iranian veterinary journal. 2014; 10(2):74-80.
  27. Heidari S, Derakhshandeh A, Firouzi R, Ansari-Lari M, Masoudian M, Eraghi V. Molecular detection of Chlamydophila abortus, Coxiella burnetii, and Mycoplasma agalactiae in small ruminants’ aborted fetuses in southern Iran. Tropical Animal Health and Production. 2018; 50(4): 779-785. DOI
  28. Iraninezhad Z, Azizzadeh M, Razavizadeh AT, Mehrzad J, Rashtibaf M. Seroepidemiological feature of Chlamydia abortus in sheep and goat population located in northeastern Iran. Veterinary Research Forum. 2020; 11 (4):423. DOI
  29. Al-Qudah KM, Sharif LA, Raouf RY, Hailat NQ, Al-Domy FM. Seroprevalence of antibodies to Chlamydophila abortus shown in Awassi sheep and local goats in Jordan. Veterinarni Medicina. 2004; 49 (12): 460. DOI
  30. Qin S-Y, Yin M-Y, Cong W. Seroprevalence and risk factors of Chlamydia abortus infection in Tibetan sheep in Gansu province northwest China. The Scientific World Journal. 2014; 1-6. DOI
  31. Borujeni MP, Bakhtiari NM, Hajikolaei MH, Mousavi M. Chlamydia abortus infection in goats in the southwest of Iran. Revue de Medecine Veterinaire. 2019; 170:9-14.
  32. Cubero-Pablo MJ, Plaza M, Pérez L, González M, León-Vizcaíno L. Seroepidemiology of chlamydial infections of wild ruminants in Spain. Journal of Wildlife Diseases. 2000; 36(1):35-47. DOI
  33. Yin L, Schautteet K, Kalmar I, Bertels G, Van Driessche E, Czaplicki G, et el. Prevalence of Chlamydia abortus in Belgian ruminants. Vlaams Diergeneeskundig Tijdschrift. 2014; 83(4):164-170. DOI
  34. Tsakos P, Siarkou V, Kastanidou C, Papadopoulos O. Epidemiological survey in sheep and goats for chlamydia and brucella (In Greek). Journal of the Hellenic Veterinary Medical Society. 2001; 52(5):410-421. DOI
  35. Čisláková L, Halánová M, Kováčová D, Štefančíková A. Occurrence of antibodies against Chlamydophila abortus in sheep and goats in the Slovak Republic. Annals of Agricultural and Environmental Medicine. 2007; 14:243-245.
  36. Majid R, Al-Hankaw O, Khder H, Al-Farwachi M. Prevalence of Chlamydophila abortion amongst local small ruminants in Ninavah province-Iraq. International Journal of Advanced Research. 2018; 6(4):1028-1032. DOI
  37. Wang FI, Shieh H, Liao YK. Prevalence of Chlamydophila abortus infection in domesticated ruminants in Taiwan. The Journal of Veterinary Medical Science. 2001; 63(11):1215-1220. DOI
Send comment about this article
CAPTCHA Image

Files

Cited by

History

  • Receive Date: 11 June 2023
  • Revise Date: 05 August 2023
  • Accept Date: 27 August 2023

Share

How to cite

Statistics