Abbreviations
FQs: fluoroquinolones
CDT: cytolethal distending toxin
LOSSIAL: sialylated lipo-oligosaccharide
AMR: antimicrobial resistance
Introduction
Campylobacter species are generally considered a component of the normal gut flora of poultry [ 1 ]. Many species of domestic poultry and wild birds may be infected with thermophilic Campylobacter spp., mainly C. jejuni followed by C. coli and rarely C. lari [ 1 , 2 ]. Ducks could be also a reservoir of Campylobacter spp. [ 3 ]. Recently, high rates of Campylobacter infection have been reported in domestic duck flocks in South Korea and Malaysia [ 4 , 5 ]. In commercial poultry flocks, Campylobacter is not found in the first 2-3 weeks of age. This initial lag phase is probably related to maternal immunity [ 2 ]. Horizontal transmission from the environment, including contaminated water, feed, fomites, wild birds, other farm animals, rodents, and insects, is the major source of Campylobacter colonization. Vertical transmission of Campylobacter is unlikely, and the eggs are not contaminated [ 1 , 2 ]. Despite extensive colonization in the cecum, colon, and cloaca (up to 109 colony-forming units/g feces), Campylobacter infections produce mild or no clinical diseases in poultry [ 1 - 3 ].
Food-borne bacterial pathogens are the most important etiologic agents of human gastroenteritis in the United States of America and worldwide [ 6 ]. Campylobacter causes more than 800 000 food-borne illnesses and 8000 hospitalizations in the USA each year [ 2 ]. The majority (50%-80%) of human campylobacteriosis cases occur through the ingestion of contaminated poultry products [ 7 ]. In a study in the United Kingdom, 50.7% of duck meat samples were infected with Campylobacter, which was comparable to chicken meat contamination (60.9%) [ 8 ]. Human infections are usually recognized by fever, diarrhea (watery/bloody), nausea, and abdominal pain after an incubation period of 2-5 days [ 1 , 2 ]. In addition, GBS/acute neuromuscular paralysis may occur as a post-infection disease in 0.1% of the infected individuals and eventually causes respiratory compromise and death [ 1 ]. Usually, Campylobacter enteritis is a self-limiting infection, but antimicrobial therapy is needed in severe cases or immune-compromised patients [ 9 ]. Fluoroquinolones (e.g., ciprofloxacin) and macrolide antibiotics (e.g., azithromycin and erythromycin) are the appropriate medications. Tetracycline and gentamicin are occasionally used as alternative agents to treat systemic infection in humans [ 6 ]. Today, these antibiotics are utilized in food animals as a growth promotor or a therapeutic medicine. In recent years, an increase in drug-resistant Campylobacter isolates, particularly to FQs, has been observed in poultry, which poses a threat to public health [ 9 ]. Moreover, the Centers for Disease Control and Prevention classified antimicrobial-resistant Campylobacter strains under "microorganisms with a threat level of serious" and estimated that the resistance rate to FQs, macrolides, and tetracyclines among Campylobacter isolates is 22%, 2%, and 49%, respectively, in the U.S. annually [ 6 , 9 ].
The pathogenesis of campylobacteriosis is not well understood. However, some of the putative virulence genes of Campylobacter which are associated with adhesion, colonization, invasion, and toxin production and are needed to induce infection have been investigated [ 7 ]. The cadF (Campylobacter adhesion to fibronectin) gene is responsible for adhesion and colonization. The pldA (Phospholipase A) and invasion-associated marker iam genes are involved in invasion [ 1 , 7 ]. Among several different cytotoxins in Campylobacter, CDT, a tripartite toxin, which is encoded by three related genes, namely cdtA, cdtB, and cdtC, has been characterized in detail. Two heterodimeric subunits CdtA and CdtC are responsible for holotoxin binding to the cell membrane, and CdtB is an enzymatically active subunit [ 7 ]. The wlaN gene encodes the β-1,3-galactosyltransferase enzyme that is responsible for sialylated lipo-oligosaccharide (LOSSIAL) production, an essential pathogenic factor of GBS [ 10 ].
Duck rearing is a main part of poultry production in some countries of the world, such as China, France, South Korea, and Malaysia [ 4 , 11 , 12 ]. As a result, the highest consumption of duck meat (over 80%) has been reported in Asian countries [ 12 ]. In Iran, this industry has also been thriving and providing a part of human needs. As mentioned above, extensive research has been conducted on Campylobacter spp. infection in chickens, but the relationship between ducks and food-borne pathogens has been poorly investigated [ 11 ]. Therefore, the current study was performed to determine the infection status of Iranian backyard ducks to thermophilic campylobacters, and also the antibiotic resistance and virulence genes of the obtained isolates.
Result
Infection rate
The results of mPCR are presented in Figure 1. In addition, the geographic distribution of thermophilic Campylobacter spp. in different backyard flocks is shown in Table 1. Out of the 28 backyard duck flocks examined, 17 (60.7%) were positive for thermophilic Campylobacter species. Moreover, out of 100 cloacal samples tested for Campylobacter spp., 27 (27%) were infected. The majority of the isolates (19/27, 70.4%) were C. coli, while only three isolates (11.1%) were C. jejuni. The remaining five (18.5%) isolates were thermophilic Campylobacter spp., but have not been identified. None of the swab samples had mixed Campylobacter infection. In the present study, C. lari was not detected.

Figure 1. Multiplex PCR assay for the identity of the 16S rRNA gene (816 bp) for Campylobacter genus, the cj0414 gene (161 bp) for C. jejuni, and the ask gene (502 bp) for C. coli. Lane NC: Negative control (deionized water), Lane M: 100-bp DNA ladder, Lane PC: Positive control (Campylobacter coli ATCC 43478), Lane 1: C. coli isolate, Lane 2: a 161-bp amplified fragment of the cj0414 gene was sequenced and confirmed as C. jejuni isolate, Lane 3: C. jejuni isolate, and Lane 4: Campylobacter spp. isolate (unidentified).
| Rural region | No. of flocks sampled | No. of positive flocks (%) | Isolated Campylobacter |
|---|---|---|---|
| North | 11 | 2 (18.2) | Campylobacter coli |
| West | 7 | 5 (71.4) | C. coli and other spp. |
| South | 4 | 4 (100.0) | C. coli and other spp. |
| East | 6 | 6 (100.0) | C. coli and C. jejuni |
| Total | 28 | 17 (60.7) | C. coli, C. jejuni, and other spp. |
Antimicrobial resistance
All 27 Campylobacter isolates were examined for resistance to seven antibiotics belonging to five antibiotic classes. As shown in Table 2, all Campylobacter isolates were resistant to ciprofloxacin (100%). Moreover, most strains exhibited resistance to ampicillin (81.5%), tetracycline (77.8%), and nalidixic acid (74.1%). Resistance to amoxicillin/clavulanic acid and erythromycin was moderate at 51.9% and 44.4%, respectively, whereas resistance to gentamicin was relatively low (25.9%). Moreover, no statistically significant association was found between Campylobacter spp. and resistance to tested antibiotics (Table 2). Thirteen AMR patterns were observed in Campylobacter isolates, eight of which were MDR, and 19 out of 27 Campylobacter isolates (70.4%) were found to be MDR (Table 3).
| Antimicrobial class | Antimicrobial | No. of resistant Campylobacter isolates (%) | Total (n=27) No. (%) | p-Value | ||
|---|---|---|---|---|---|---|
| C. coli (n=19) | C. jejuni (n=3) | Other spp. (n=5) | ||||
| Fluoroquinolones | CIP | 19 (100.0) | 3 (100.0) | 5 (100.0) | 27 (100.0) | NC |
| NAL | 15 (78.9) | 1 (33.3) | 4 (80.0) | 20 (74.1) | 0.297ns | |
| Macrolides | ERY | 7 (36.8) | 1 (33.3) | 4 (80.0) | 12 (44.4) | 0.227ns |
| Tetracyclines | TET | 15 (78.9) | 1 (33.3) | 5 (100.0) | 21 (77.8) | 0.119ns |
| β-Lactams | AMP | 17 (89.5) | 1 (33.3) | 4 (80.0) | 22 (81.5) | 0.072ns |
| AMC | 10 (52.6) | 1 (33.3) | 3 (60.0) | 14 (51.9) | 1.000ns | |
| Aminoglycosides | GEN | 3 (15.8) | 1 (33.3) | 3 (60.0) | 7 (25.9) | 0.092ns |
| Abbreviations: CIP: Ciprofloxacin, NAL: Nalidixic acid, ERY: Erythromycin, TET: Tetracycline, AMP: Ampicillin, AMC: Amoxicillin/clavulanic acid, GEN: Gentamicin, NC: Not calculated, and ns: Not statistically significant (represents no significant association between Campylobacter spp. and AMR; p > 0.05) | ||||||
| Antibiotic resistance pattern | No. of Campylobacter isolates in a given AMR pattern (%) | |||
|---|---|---|---|---|
| C. coli (n=19) | C. jejuni (n=3) | Other spp. (n=5) | Total (n=27) | |
| CIP | --- | 2 (66.7) | --- | 2 (7.4) |
| CIP-NAL | 1 (5.3) | --- | --- | 1 (3.7) |
| CIP-TET | 1 (5.3) | --- | --- | 1 (3.7) |
| CIP-NAL-TET | --- | --- | 1 (20.0) | 1 (3.7) |
| CIP-NAL-AMP-AMC | 3 (15.8) | --- | --- | 3 (11.1) |
| CIP-NAL-TET-AMP* | 3 (15.8) | --- | --- | 3 (11.1) |
| CIP-ERY-TET-AMP* | 1 (5.3) | --- | --- | 1 (3.7) |
| CIP-NAL-TET-AMP-AMC* | 4 (21.1) | --- | --- | 4 (14.8) |
| CIP-ERY-TET-AMP-AMC* | 1 (5.3) | --- | --- | 1 (3.7) |
| CIP-NAL-ERY-TET-AMP* | 2 (10.5) | --- | --- | 2 (7.4) |
| CIP-ERY-TET-AMP-GEN* | 1 (5.3) | --- | 1 (20.0) | 2 (7.4) |
| CIP-NAL-ERY-TET-AMP-AMC* | --- | --- | 1 (20.0) | 1 (3.7) |
| CIP-NAL-ERY-TET-AMP-AMC-GEN* | 2 (10.5) | 1 (33.3) | 2 (40.0) | 5 (18.6) |
| Total | 19 (100.0) | 3 (100.0) | 5 (100.0) | 27 (100.0) |
| No. of MDR* isolates (%) | 14 (73.7) | 1 (33.3) | 4 (80.0) | 19 (70.4) |
| * MDR pattern: resistance of Campylobacter isolates to at least three antimicrobial classes | ||||
Virulence genes
The results of PCR are presented in Figure 2. In total, 27 Campylobacter isolates were screened for the presence of seven putative virulence and toxin genes, and the details of our findings are summarized in Table 4. The cadF (adhesion) gene with a positivity rate of 92.6% was the most prevalent gene. All C. coli and C. jejuni isolates were positive for this gene. Regarding invasion-related genes, 2 (7.4%) of the isolates carried pldA, while iamA was not detected in any of the isolates. Among the genes encoding CDT, cdtA, cdtB, and cdtC were present in 25.9%, 85.2%, and 29.6% of the isolates, respectively. Moreover, 25.9% of stains possessed the cdtABC gene cluster. The wlaN gene associated with LOSSIAL production was found in 14 (51.9%) of the isolates. A statistically significant association was observed between Campylobacter spp. and the majority of virulence-related genes (cadF, cdtA, cdtB, cdtC, cdtABC, and wlaN) (p < 0.05). Six virulence gene patterns (genotypes) were found in 25 of 27 Campylobacter isolates (92.5%) (Table 5).

Figure 2. Amplified PCR products of virulence genes (except the iamA gene) among Campylobacter isolates from backyard ducks. Lane M: 100-bp DNA ladder, Lane 1: negative control (deionized water), Lane 2: cadF gene positive, Lane 3: pldA gene positive, Lane 4: cdtA gene positive, Lane 5: cdtC gene positive, Lane 6: cdtB gene positive, and Lane 7: wlaN gene positive.
| Campylobacter Species | No. of isolates | No. of positive isolates for a specific gene (%) | |||||||
|---|---|---|---|---|---|---|---|---|---|
| cadF | iamA | pldA | cdtA | cdtB | cdtC | cdtABC | wlaN | ||
| C. coli | 19 | 19 (100.0) | 0 | 1 (5.3) | 2 (10.5) | 18 (94.7) | 3 (15.8) | 2 (10.5) | 13 (68.4) |
| C. jejuni | 3 | 3 (100.0) | 0 | 1 (33.3) | 3 (100.0) | 3 (100.0) | 3 (100.0) | 3 (100.0) | 1 (33.3) |
| Other spp. | 5 | 3 (60.0) | 0 | 0 | 2 (40.0) | 2 (40.0) | 2 (40.0) | 2 (40.0) | 0 |
| Total | 27 | 25 (92.6) | 0 | 2 (7.4) | 7 (25.9) | 23 (85.2) | 8 (29.6) | 7 (25.9) | 14 (51.9) |
| p-Value | 0.037* | NC | 0.242 ns | 0.003* | 0.016* | 0.007* | 0.003* | 0.010* | |
| Abbreviations: NC: Not calculated, and ns: Not statistically significant | |||||||||
| * indicates a statistically significant association between Campylobacter spp. and virulence genes (p < 0.05) | |||||||||
| Virulence gene pattern | No. of Campylobacter isolates in a given genotype (%) | ||||
|---|---|---|---|---|---|
| C. coli (n=19) | C. jejuni (n=3) | Other spp. (n=5) | Total (n=27) | ||
| cadF | 1 (5.3) | --- | 1 (20.0) | 2 (7.4) | |
| cadF-cdtB | 4 (22.0) | --- | --- | 4 (14.8) | |
| cadF-cdtB-wlaN | 11 (57.9) | --- | --- | 11 (40.7) | |
| cadF-cdtB-cdtC-wlaN | 1 (5.3) | --- | --- | 1 (3.7) | |
| cadF-cdtA-cdtB-cdtC | 1 (5.3) | 2 (66.7) | 2 (40.0) | 5 (18.5) | |
| cadF-pldA-cdtA-cdtB-cdtC-wlaN | 1 (5.3) | 1 (33.3) | --- | 2 (7.4) | |
| Total | 19 (100.0) | 3 (100.0) | 3 (60.0) | 25 (92.5) | |
Statistical analysis of phenotypic antimicrobial resistance with virulence genes
There was no significant correlation between phenotypic resistance to antibiotics and genotype (virulence genes) in Campylobacter spp. isolated from backyard ducks (rs = -0.35, p = 0.08).
Discussion
Backyard poultry can serve as a transmission source for a variety of food-borne pathogens, including thermophilic Campylobacter spp., for other bird and human populations because biosecurity practices in backyard flocks are commonly not monitored and executed [ 13 ]. There is little data on the on-farm prevalence of Campylobacter in domestically reared duck flocks. Therefore, this research aimed to estimate the infection rate, AMR, and genes associated with the virulence of Campylobacter spp. among backyard ducks in Iran.
In the present study, thermophilic campylobacters were confirmed using both the standard culture methods and mPCR in 27% (27/100) of the cloacal samples of backyard ducks. This finding was in agreement with the Campylobacter infection rate in chicken meat samples in Iran, which was reported at 28.9% (26/90) [ 14 ], while lower isolation rates of Campylobacter spp. were identified in the urban duck fecal samples in Iran (17.3%) [ 15 ] and in turkey, game bird (pheasant and quail), and duck cecal samples in Canada (11.9%, 4.5%, and 3.4%, respectively) [ 16 ]. On the other hand, a higher level of Campylobacter infection was found among the duck and goose intestinal samples in Iran (34.2%) [ 17 ] and in mallard duck and white-fronted goose cloacal samples in Poland (32.8% and 45.5%, respectively) [ 18 ]. Although C. jejuni was reported as the prevailing species in most studies, the most prevalent species identified in the current study was C. coli (70.4%). This finding was in accordance with the research completed in Spain and Germany [ 19 , 20 ]. The results of this study showed that Campylobacter infection is highly prevalent in ducks and these hosts can be considered the main source of Campylobacter spp. (both C. jejuni and C. coli) and a possible risk of human campylobacteriosis.
In this research, the resistance rate to ciprofloxacin was 100%, and high resistance to nalidixic acid was observed among Campylobacter isolates (74.1%), while C. coli (78.9%) was more resistant to nalidixic acid than C. jejuni (33.3%). Similarly, in a study by Wysok et al. (2020), most of the Campylobacter strains from domestic goose cecal samples revealed resistance to ciprofloxacin (92%) and nalidixic acid (88%) [ 21 ]. In another study, high resistance to ciprofloxacin was found among human isolates in Europe, China, and Korea [ 22 ]. Contrarily, previous studies reported relatively low resistance to ciprofloxacin and nalidixic acid among Campylobacter strains [ 23 , 24 ]. Overall, the very high resistance rate to FQs in this study may result from the expansive usage of this class of antimicrobials, such as enrofloxacin and sarafloxacin, to treat certain infections (e.g. Escherichia coli) in the poultry industry [ 25 ].
In the present study, 44.4% of Campylobacter isolates (36.8% C. coli and 33.3% C. jejuni) indicated moderate resistance to erythromycin. Our result was similar to those of Wei et al. (2014) [ 4 ] and Ghoneim et al. (2020) [ 26 ]. On the other hand, all Campylobacter strains isolated from layer hen cloacal swabs and farm environment samples in Tunisia were resistant to erythromycin [ 27 ]. Overall, the findings of this research showed that the use of macrolides (e.g., spiramycin and tylosin) for therapeutic purposes and growth promotion in commercial poultry has caused the high prevalence of macrolide-resistant Campylobacter isolates in backyard flocks [ 6 ].
High resistance to tetracycline was shown in Campylobacter strains (77.8%) in this research, while C. coli was more resistant to this antibiotic compared to C. jejuni (78.9% vs. 33.3%). Similarly, high resistance to tetracycline was reported in Iran (70.6%) [ 28 ] and China (nearly 100%) [ 29 ]. Conversely, a study in Belgium showed relatively low or moderate resistance to tetracycline (48.3%) among Campylobacter strains isolated from the intestinal samples of international travelers [ 30 ]. Our findings indicated that tetracyclines should be used cautiously to treat animals and humans.
In the current research, the rate of gentamicin-resistant Campylobacter strains was relatively low (25.9%) and C. jejuni (33.3%) exhibited higher resistance to gentamicin than C. coli (15.8%). Similarly, Qin et al. (2012) reported a relatively low rate of resistance against gentamicin (>20%) among Campylobacter isolates from broiler chickens [ 31 ]. In another study, relatively low resistance to gentamicin was estimated among Campylobacter strains obtained from human and chicken sources in the U.S. [ 25 ]. Consequently, aminoglycosides (e.g., gentamicin) can be utilized to treat acute and systemic Campylobacter infections in humans and to prevent bacterial infections in various avian species [ 6 , 25 ].
In our study, 81.5% of Campylobacter isolates (89.5% of C. coli vs. 33.3% of C. jejuni) were resistant to ampicillin. These results were similar to those of Giacomelli et al. (2014) [ 32 ] and Casagrande Proietti et al. (2020) [ 33 ]. However, beta-lactams, such as penicillin, are the most commonly used antibiotics for turkeys in Germany [ 34 ]. On the other hand, 51.9% of Campylobacter strains (52.6% C. coli and 33.3% C. jejuni) demonstrated moderate resistance to amoxicillin/clavulanic acid (co-amoxiclav) in this investigation, which was similar to previous estimates by Jehanne et al. (2021) in France [ 35 ] and Hadiyan et al. (2022) in Iran [ 36 ]. As a result, oral beta-lactams, such as co-amoxiclav, can be an appropriate choice to treat human Campylobacter infection due to the rising resistance of C. jejuni and C. coli to FQs, erythromycin, and tetracycline [ 25 ].
Overall, C. coli strains identified in the present research had more resistance to important antibiotics than C. jejuni isolates. Furthermore, 70.4% of Campylobacter isolates exhibited resistance against three or more antimicrobial classes. In this study, the prevalence rate of MDR was much higher for C. coli than for C. jejuni (73.7% vs. 33.3%), which was similar to the results of an investigation conducted in China [ 37 ]. Determining the virulence factors of Campylobacter is very important to better understand the infection rate [ 18 ]. Therefore, several critical virulence genes were identified in this research.
The prevalence of cadF, the most prevalent virulence gene, among Campylobacter isolates obtained from backyard ducks was 92.6% (25/27), which enhances the ability of Campylobacter to attach to host fibronectin and colonization of the intestine [ 7 ]. This result was similar to the research conducted by Kim et al. (2019) in South Korea (93.3%) [ 38 ] and Rossler et al. (2020) in Argentina (92%) [ 39 ], while the low prevalence rate of the cadF gene was detected in broiler chickens in South Africa (23.1%) [ 40 ]. In general, the prevalence of virulence genes responsible for adhesion in Campylobacters is very high regardless of the source and geographic area [ 18 ].
Both the invasion-associated marker (iam) and pldA genes encode pathogenic factors related to the Campylobacter invasion of intestinal epithelial cells. Moreover, the pldA gene encodes an outer membrane protein, phospholipase A, that is involved in hemolytic activity [ 7 ]. In this study, none of the Campylobacter isolates had the iamA gene, which was consistent with the results of a previous investigation in Brazil [ 41 ]. In addition, 7.4% (2/27) of the isolates possessed the pldA gene in our study. Similarly, a low frequency of the pldA gene was found among strains isolated from duck samples in South Korea (3.6%) [ 42 ] and individuals with diarrhea in Iran (15%) [ 43 ]. In contrast, the high prevalence rates of iam and pldA genes have been reported in earlier studies [ 44 , 45 ]. The reasons for the considerable diversity of iam and pldA genes are not yet elucidated [ 41 ].
CDT is a key marker for Campylobacter pathogenicity in humans, which is produced by three linked genes named cdtA, cdtB, and cdtC. The CdtB subunit has type I DNase activity and causes cell cycle arrest at the G2/M phase, while CdtA and CdtC subunits are responsible for the binding of CDT and its internalization into host cells. Ultimately, CDT leads to distention and cell death. However, the role of this toxin during Campylobacter colonization in the avian hosts is unclear [ 46 ]. The presence of three cdt genes is necessary for the function of CDT holotoxin [ 7 , 46 ]. In this investigation, a relatively low frequency of the cdtABC gene cluster among backyard duck Campylobacter isolates was detected (25.9%), while all C. jejuni strains possessed the cdtABC genes. A similar rate of cdtABC was reported among all Campylobacter isolates from American crows in the U.S. and healthy pet birds in Iran, with a range of 20%-33% [ 47 , 48 ], while the higher frequency of the cdtABC cluster was previously detected in Ireland (86%) [ 49 ] and Spain (100%) [ 50 ]. In general, the prevalence of CDT (cdtABC) genes in different research is highly variable, which may be due to heterogeneity in the genetic reservoir of Campylobacter strains [ 51 ].
The wlaN gene is responsible for the biosynthesis of sialylated lipo-oligosaccharide (LOSSIAL), which has a structure similar to human GM1 ganglioside. The LOSSIAL factor may cause autoimmune diseases, such as GBS polyneuropathy, following Campylobacter infection [ 10 ]. In this research, 51.9% of the Campylobacter strains had the wlaN gene, while this gene was more prevalent among C. coli isolates than C. jejuni (68.4% vs. 33.3%). The frequency of wlaN was 10% in wild birds in South Korea [ 52 ], 36% in human and broiler chicken sources in Egypt [ 53 ], and 44% in human stool samples in Hungary [ 54 ], which was lower than our result. Previous investigations have shown no association between the source of isolates and the presence of the wlaN gene [ 10 ].
Virulence gene patterns in the current study demonstrated that C. jejuni isolates carried more virulence factors than C. coli. In other words, C. jejuni strains are likely more pathogenic. Finally, we indicated a statistically significant association between Campylobacter spp. and the presence of virulence genes, especially genes related to the production of cytotoxins (CDT) and the occurrence of GBS. Campylobacter isolates obtained from backyard ducks can be a threat to food hygiene and human health.
In conclusion, the current study highlights that backyard ducks harbor commensal thermophilic campylobacters and can be regarded as potential reservoirs of Campylobacter infection for other hosts. Awareness of owners’ backyard poultry flocks about the risk of the transmission of zoonotic diseases, including campylobacteriosis, hygiene and biosecurity measures (e.g., cleaning and disinfection, daily water and food change, rodent and insect control, and keeping wild birds away from backyard flocks), veterinary care, and antibiotic monitoring are essential for improving husbandry practices and avian health in backyard flocks, and decrease the prevalence of zoonotic pathogens between commercial and backyard poultry farms, leading to reduced infection in humans.
Materials and Methods
Sample collection
This study was conducted on June 2021-July 2022 in different geographical regions of the rural area of Amol (a city in northern Iran). A total of 100 healthy ducks from 28 backyard flocks were tested for Campylobacter infection. A cloacal swab sample was taken from all birds. To do this, the vent was cleaned with disinfectant iodine solution (10%) and a swab was inserted into the cloaca and was rotated. The samples were stored in a Cary-Blair transport medium (12.6 g/991 ml; HiMedia, India) at 4°C and were directly transmitted to the laboratory. The swabs were examined 4 h after sampling.
Bacterial examination
The swab samples were cultured in enrichment Preston broth consisting of Preston broth base (25 g/945 ml; MilliporeSigma, USA), Campylobacter selective supplement IV, modified with polymyxin [B 2500 IU/500 mL], rifampicin [5 mg/500 mL], trimethoprim lactate [5 mg/500 mL], and amphotericin [B 5 mg/500 mL] (MilliporeSigma, USA), and 5% lysed sheep blood (Zistroyesh, Iran). The inoculated broths were incubated at 37°C for 4 h, followed by 44 ± 4 h at 42°C in a microaerobic chamber (85% nitrogen, 10% carbon dioxide, and 5% oxygen) (Anaerocult® C; MilliporeSigma, USA). One loop full of enriched sample (1 µl) was cultivated on Preston selective agar containing Campylobacter agar base (19.75 g/500 mL; HiMedia, India), 5% defibrinated sheep blood, and mentioned antibiotics at the same doses. Bacterial cultures were incubated in a microaerobic environment at 42°C for 48 h. Subsequently, suspected colonies of Campylobacter were purified on brain heart infusion agar (52 g/L; MilliporeSigma, USA) with 5% sheep blood. Plates were incubated for 24 h at 42°C in a similar atmosphere. Preliminary recognition of Campylobacter isolates was performed based on colony characteristics (greyish, round, flat, and shiny with a regular edge), examination of typical cellular shapes ("S" or "seagull-like"), rapid darting motility using the phase-contrast microscopy, and biochemical reactions consisting of oxidase test (tetramethyl-p-phenylene-diamine), catalase test (3% H2O2), and glucose fermentation. Finally, a molecular assay was performed to confirm presumptive colonies [ 1 ].
DNA extraction
A pure single colony of each Campylobacter isolate was suspended in 200 µl sterile deionized H2O. Bacterial DNA was prepared by boiling at 95°C for 15 min. The samples were centrifuged at 11000 rpm for 2.5 min and the supernatants were stored at -20°C until utilization [ 55 ].
Genus and species identification
A mPCR was performed following the method described previously by Yamazaki-Matsune et al. (2007) [ 56 ]. The target genes of 16S rRNA for the Campylobacter genus, ask (aspartokinase) for C. coli, glyA (serine hydroxymethyltransferase) for C. lari, and cj0414 (oxidoreductase) for C. jejuni were amplified using specific primer sets (Table 6). Briefly, the amplification reaction was performed in a 25 µl final volume, including 2 µl DNA of bacteria, 12.5 µl PCR Master Mix 2X (Sinaclon, Iran), 0.5 µl forward and reverse primers (Sinaclon, Iran), and 6.5 µl distilled deionized H2O. The mPCR was performed by a thermocycler (Bio-Rad, USA) according to the following program: an initial 15 min denaturation at 95°C, 35 cycles of denaturation (95°C, 0.5 min), annealing (58°C, 1.5 min), extension (72°C, 1 min), and a final step of 7 min at 72°C. Amplified products (10 µl each) were run on electrophoresis 1.5% agarose gel stained with DNA-safe stain (Sinaclon, Iran) in 1X tris-acetate-EDTA buffer and were seen under UV light. The 100-bp DNA ladder (Sinaclon, Iran) was employed as a molecular weight standard. C. coli strain ATCC 43478 and sterile deionized H2O were utilized as positive and negative controls, respectively. Moreover, one of the C. jejuni isolates obtained in this study was subjected to sequencing of a 161-bp PCR amplicon of the cj0414 gene by the Sanger sequencing method (Codon Genetic Group, Iran). Based on nucleotide BLAST analysis, the sequence data of the cj0414 gene and C. jejuni strain 2016-IZSVE-19-111250 (GenBank: CP053659.1) from Italy were 99.24% identical.
| Target gene | Primer | Sequences (5ʹ- 3ʹ) | Annealing temperature (°C) | Size (bp) | Reference |
|---|---|---|---|---|---|
| 16S rRNA (Campylobacter) | C412F | GGATGACACTTTTCGGAGC | 58 | 816 | [ 56 ] |
| C1228R | CATTGTAGCACGTGTGTC | ||||
| ask (C. coli) | CC18F | GGTATGATTTCTACAAAGCGAG | 58 | 502 | [ 56 ] |
| CC519R | ATAAAAGACTATCGTCGCGTG | ||||
| glyA (C. lari) | CLF | TAGAGAGATAGCAAAAGAGA | 58 | 251 | [ 56 ] |
| CLR | TACACATAATAATCCCACCC | ||||
| cj0414 (C. jejuni) | C-1 | CAAATAAAGTTAGAGGTAGAATGT | 58 | 161 | [ 56 ] |
| C-3 | CCATAAGCACTAGCTAGCTGAT | ||||
| cadF | cadF-F2B | TTGAAGGTAATTTAGATATG | 45 | 400 | [ 55 ] |
| cadF-R1B | CTAATACCTAAAGTTGAAAC | ||||
| iamA | iamA F | GCGCAAAATATTATCACCC | 52 | 518 | [ 59 ] |
| iamA R | TTCACGACTACTATGCGG | ||||
| pldA | pldA-84 | AAGCTTATGCGTTTTT | 45 | 913 | [ 55 ] |
| Pld-981 | TATAAGGCTTTCTCCA | ||||
| cdtA | DS-18 | CCTTGTGATGCAAGCAATC | 49 | 370 | [ 55 ] |
| DS-15 | ACACTCCATTTGCTTTCTG | ||||
| cdtB | cdtB-113 | CAGAAAGCAAATGGAGTGTT | 51 | 620 | [ 55 ] |
| cdtB-713 | AGCTAAAAGCGGTGGAGTAT | ||||
| cdtC | cdtC-192 | CGATGAGTTAAAACAAAAAGATA | 47 | 182 | [ 55 ] |
| cdtC-351 | TTGGCATTATAGAAAATACAGTT | ||||
| wlaN | wlaN F | AGGGTTTTAATAGTTGCAATTTCTC | 50 | 912 | [ 60 ] |
| wlaN R | ATGAAATTTTTAATATCTTTACGGAATTAA |
Antibiotic susceptibility testing
The antimicrobial sensitivity of identified Campylobacter strains was assessed using Kirby Bauer’s disk diffusion test according to the CLSI guideline for fastidious organisms [ 57 ]. The used antibiotic disks (Padtanteb, Iran) consisted of ciprofloxacin (CIP, 5 µg), nalidixic acid (NA, 30 µg), erythromycin (E, 15 µg), tetracycline (TE, 30 µg), ampicillin (AM, 10 µg), amoxicillin/clavulanic acid (AMC, 20/10 µg), and gentamicin (GM, 10 µg). Bacterial colonies were suspended in nutrient broth (25g/L; MilliporeSigma, USA) to acquire a McFarland turbidity of 0.5. The prepared suspensions were cultured on Mueller-Hinton agar media (38g/L; MilliporeSigma, USA) containing 5% defibrinated sheep blood, and were incubated microaerobically at 42°C for 24 h. The zone of bacterial growth inhibition was measured for each antibiotic and evaluated under interpretive criteria provided by CLSI. Acquired resistance to at least one drug in three or more antibiotic classes was considered MDR [ 58 ].
Detection of virulence genes
The genomic DNA was amplified by PCR to detect genes involved in adhesion (cadF), invasion (iamA and pldA), production of toxin (cdtA, cdtB, cdtC), and biosynthesis of sialylated lipooligosaccharide (wlaN) using the primer sets listed in Table 6. The reaction mixture (25 µl) consisted of 2 µl DNA of bacteria, 12.5 µl PCR Master Mix 2X (Sinaclon, Iran), 1 µl of each primer (Sinaclon, Iran), and 8.5 µl deionized H2O. The PCR assays were completed according to the following conditions: initial denaturation at 95°C for 5 min, 35 cycles of denaturation (95°C, 1 min), annealing at a temperature specific to the primer pair for 1 min, extension (72°C, 1 min), and a final extension step at 72°C for 6 min. The PCR product of each gene (10 µl each) was electrophoresed on 1.5% agarose gel stained with DNA-safe stain (Sinaclon, Iran) in 1X TAE buffer and was visualized under UV light. Sterile deionized H2O was used as the negative control. The amplicon size was determined using the 100-bp DNA ladder.
Statistical analysis
Statistical analysis was performed by SPSS 23. In this study, the correlation between phenotypic resistance to antibiotics and genotype (virulence genes) was determined using Spearman's correlation coefficient. Furthermore, Fisher's exact test was used to evaluate the association between Campylobacter spp. and phenotypic resistance to antibiotics and virulence genes. p-value < 0.05 was considered statistically significant.
Authors' Contributions
H.G., and R.A.J. conceived and planned the experiments. H.G., R.A.J., D.G., and R.K. carried out the experiments. H.G. took the lead in writing the manuscript. All authors provided critical feedback and helped shape the research, analysis and manuscript.
Acknowledgements
We would like to thank the Vice Chancellor for Research of Shahid Chamran University of Ahvaz (Ahvaz, Iran) for financial support.
Competing Interests
The authors declare that there is no conflict of interest.
Abbreviations-Cont'd
MDR: multidrug-resistant
rs: Spearman's rank correlation coefficient
mPCR: multiplex polymerase chain reaction
ATCC: American-type culture collection
CLSI: Clinical and Laboratory Standards Institute
GBS: Guillain-Barre syndrome
References
- Zhang Q, Sahin O. Diseases of poultry. Hoboken, NJ: John Wiley & Sons; 2020.
- Sahin O, Kassem II, Shen Z, Lin J, Rajashekara G, Zhang Q. Campylobacter in poultry: ecology and potential interventions. Avian Dis. 2015 Jun; 59(2):185-200. DOI
- Han X, Guan X, Zeng H, Li J, Huang X, Wen Y, et al. Prevalence, antimicrobial resistance profiles and virulence-associated genes of thermophilic Campylobacter spp. isolated from ducks in a Chinese slaughterhouse. Food Control. 2019 Apr; 104(2):157-166. DOI
- Wei B, Cha SY, Kang M, Roh JH, Seo HS, Yoon RH, et al. Antimicrobial susceptibility profiles and molecular typing of Campylobacter jejuni and Campylobacter coli isolates from ducks in South Korea. Appl Environ Microbiol. 2014 Dec; 80(24):7604-10. DOI
- Jafari S, Ebrahimi M, Luangtongkum T. The worldwide trend of Campylobacter spp., infection from duck-related isolates and associated phenotypic and genotypic antibiotic resistance, since 1985: identifying opportunities and challenges for prevention and control. Poult Sci. 2021 Aug; 100(8):101213. DOI
- Shen Z, Wang Y, Zhang Q, Shen J. Antimicrobial resistance in Campylobacter spp. Microbiol Spectr. 2018 Apr; 6(2)DOI
- Kumar A, Gangaiah D, Torrelles JB, Rajashekara G. Polyphosphate and associated enzymes as global regulators of stress response and virulence in Campylobacter jejuni. World J Gastroenterol. 2016 Sep; 22(33):7402-14. DOI
- Colles FM, Ali JS, Sheppard SK, McCarthy ND, Maiden MCJ. Campylobacter populations in wild and domesticated Mallard ducks (Anas platyrhynchos). Environ Microbiol Rep. 2011 Oct; 3(5):574-80. DOI
- McCrackin MA, Helke KL, Galloway AM, Poole AZ, Salgado CD, Marriott BP. Effect of antimicrobial use in agricultural animals on drug-resistant foodborne campylobacteriosis in humans: a systematic literature review. Crit Rev Food Sci Nutr. 2016 Oct; 56(13):2115-32. DOI
- Guirado P, Paytubi S, Miro E, Iglesias-Torrens Y, Navarro F, Cerda-Cuellar M, et al. Differential distribution of the wlaN and cgtB genes, associated with Guillain-Barré Syndrome, in Campylobacter jejuni isolates from humans, broiler chickens, and wild birds. Microorganisms. 2020 Feb; 8(3):325. DOI
- Adzitey F, Rusul G, Huda N, Cogan T, Corry J. Prevalence, antibiotic resistance and RAPD typing of Campylobacter species isolated from ducks, their rearing and processing environments in Penang, Malaysia. Int J Food Microbiol. 2012 Mar; 154(3):197-205. DOI
- Wei B, Cha SY, Yoon RH, Kang M, Roh JH, Seo HS, et al. Prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail chicken and duck meat in South Korea. Food Control. 2016 Apr; 62:63-8. DOI
- Madsen JM, Zimmermann NG, Timmons J, Tablante NL. Evaluation of Maryland backyard flocks and biosecurity practices. Avian Dis. 2013 Jun; 57(2):233-7. DOI
- Fani F, Aminshahidi M, Firoozian N, Rafaatpour N. Prevalence, antimicrobial resistance, and virulence-associated genes of Campylobacter isolates from raw chicken meat in Shiraz, Iran. Iran J Vet Res. 2019 Oct; 20(4):283-8.
- Kafshdouzan K, Ashrafi Tamai I, Pouyan S. Detection of faecal contamination with Campylobacter jujuni and Campylobacter coli in urban ducks in the north of Iran. J. Vet. Res. 2019 Jun; 74(2):283-9. DOI
- Varga C, Guerin MT, Brash ML, Slavic D, Boerlin P, Susta L. Antimicrobial resistance in Campylobacter jejuni and Campylobacter coli isolated from small poultry flocks in Ontario, Canada: A two year surveillance study. PLoS One. 2019 Aug; 14(8):e0221429. DOI
- Jamali H, Ghaderpour A, Radmehr B, Chuan Wei KS, Chai LC, Ismail S. Prevalence and antimicrobial resistance of Campylobacter species isolates in ducks and geese. Food Control. 2015 Apr; 50:328-30. DOI
- Wysok B, Sołtysiuk M, Stenzel T. Wildlife waterfowl as a source of pathogenic Campylobacter strains. Pathogens. 2022 Jan; 11(2):113. DOI
- Antilles N, Sanglas A, Cerda-Cuellar M. Free-living waterfowl as a source of zoonotic bacteria in a dense wild bird population area in Northeastern Spain. Transbound Emerg Dis. 2015 Oct; 62(5):516-21. DOI
- Ahmed MFEM, El Adawy H, Hotzel H, Tomaso H, Neubauer H, Kemper N, et al. Prevalence, genotyping and risk factors of thermophilic Campylobacter spreading in organic turkey farms in Germany. Gut Pathog. 2016 Jun; 8:28. DOI
- Wysok B, Wojtacka J, Wiszniewska-Łaszczych A, Szteyn J. Antimicrobial resistance and virulence properties of Campylobacter spp. originating from domestic geese in Poland. Animals (Basel).. 2020 Apr; 10(4):742. DOI
- Wei B, Kang M. In vitro activity of fosfomycin against Campylobacter isolates from poultry and wild birds. PLoS One. 2018 Jul; 13(7):e0200853. DOI
- Mirzaie S, Hassanzadeh M, Bashashati M, Barrin A. Campylobacter occurrence and antimicrobial resistance in samples from ceca of commercial turkeys and quails in Tehran, Iran. International Research Journal of Microbiology. 2011 Oct; 2(9):338-42.
- Suman Kumar M, Ramees TP, Dhanze H, Gupta S, Dubal ZB, Kumar A. Occurrence and antimicrobial resistance of Campylobacter isolates from broiler chicken and slaughter house environment in India. Anim Biotechnol. 2023 Apr; 34(2):199-207. DOI
- Tang Y, Fang L, Xu C, Zhang Q. Antibiotic resistance trends and mechanisms in the foodborne pathogen, Campylobacter. Anim Health Res Rev. 2017 Dec; 18(2):87-98. DOI
- Ghoneim NH, Sabry MA, Ahmed ZS, Elshafiee EA. Campylobacter species isolated from chickens in Egypt: molecular epidemiology and antimicrobial resistance. Pakistan J. Zool. 2020 Jun; 52(3):917. DOI
- Gharbi M, Bejaoui A, Hamrouni S, Arfaoui A, Maaroufi A. Persistence of Campylobacter spp. in poultry flocks after disinfection, virulence, and antimicrobial resistance traits of recovered isolates. Antibiotics (Basel).. 2023 May; 12(5):890. DOI
- Rahimi E, Ameri M. Antimicrobial resistance patterns of Campylobacter spp. isolated from raw chicken, turkey, quail, partridge, and ostrich meat in Iran. Food Control. 2011 Aug; 22(8):1165-70. DOI
- Ma L, Wang Y, Shen J, Zhang Q, Wu C. Tracking Campylobacter contamination along a broiler chicken production chain from the farm level to retail in China. Int J Food Microbiol. 2014 Jul; 181:77-84. DOI
- Post A, Martiny D, van Waterschoot N, Hallin M, Maniewski U, Bottieau E, et al. Antibiotic susceptibility profiles among Campylobacter isolates obtained from international travelers between 2007 and 2014. Eur J Clin Microbiol Infect Dis. 2017 Nov; 36(11): 2101-7. DOI
- Qin S, Wang Y, Zhang Q, Chen X, Shen Z, Deng F, et al. Identification of a novel genomic island conferring resistance to multiple aminoglycoside antibiotics in Campylobacter coli. Antimicrob Agents Chemother. 2012 Oct; 56(10):5332-9. DOI
- Giacomelli M, Salata C, Martini M, Montesissa C, Piccirillo A. Antimicrobial resistance of Campylobacter jejuni and Campylobacter coli from poultry in Italy. Microb Drug Resist. 2014 Apr; 20(2):181-8. DOI
- Casagrande Proietti P, Guelfi G, Bellucci S, De Luca S, Di Gregorio S, Pieramati C, et al. Beta-lactam resistance in Campylobacter coli and Campylobacter jejuni chicken isolates and the association between blaOXA-61 gene expression and the action of β-lactamase inhibitors. Vet Microbiol. 2020 Feb; 241:108553. DOI
- Tenhagen BA, Alt K, Kasbohrer A, Kollas C, Pfefferkorn B, Naumann S, et al. Comparison of antimicrobial resistance of thermophilic Campylobacter isolates from conventional and organic turkey meat in Germany. Foodborne Pathog Dis. 2020 Dec; 17(12):750-7. DOI
- Jehanne Q, Benejat L, Ducournau A, Domingues-Martins C, Cousinou T, Bessede E, et al. Emergence of erythromycin resistance methyltransferases in Campylobacter coli strains in France. Antimicrob Agents Chemother. 2021 Oct; 65(11):e0112421. DOI
- Hadiyan M, Momtaz H, Shakerian A. Prevalence, antimicrobial resistance, virulence gene profile and molecular typing of Campylobacter species isolated from poultry meat samples. Vet Med Sci. 2022 Nov; 8(6):2482-93. DOI
- Li B, Ma L, Li Y, Jia H, Wei J, Shao D, et al. Antimicrobial resistance of Campylobacter species isolated from broilers in live bird markets in Shanghai, China. Foodborne Pathog Dis. 2017 Feb; 14(2):96-102. DOI
- Kim J, Park H, Kim J, Kim JH, Jung JI, Cho S, et al. Comparative analysis of aerotolerance, antibiotic resistance, and virulence gene prevalence in Campylobacter jejuni isolates from retail raw chicken and duck meat in South Korea. Microorganisms. 2019 Oct; 7(10):433. DOI
- Rossler E, Olivero C, Soto LP, Frizzo LS, Zimmermann J, Rosmini MR, et al. Prevalence, genotypic diversity and detection of virulence genes in thermotolerant Campylobacter at different stages of the poultry meat supply chain. Int J Food Microbiol. 2020 Aug; 326:108641. DOI
- Ramatla T, Mileng K, Ndou R, Tawana M, Mofokeng L, Syakalima M, et al. Campylobacter jejuni from slaughter age broiler chickens: genetic characterization, virulence, and antimicrobial resistance genes. Int J Microbiol. 2022 May; 2022:1713213. DOI
- SierraArguello YM, Perdoncini G, Rodrigues LB, Ruschel Dos Santos L, Apellanis Borges K, Quedi Furian T, et al. Identification of pathogenic genes in Campylobacter jejuni isolated from broiler carcasses and broiler slaughterhouses. Sci Rep. 2021 Feb; 11(1):4588. DOI
- Guk JH, Kim J, Song H, Kim J, An JU, Kim J, et al. Hyper-aerotolerant Campylobacter coli from duck sources and its potential threat to public health: virulence, antimicrobial resistance, and genetic relatedness. Microorganisms. 2019 Nov; 7(11):579. DOI
- Ghorbanalizadgan M, Bakhshi B, Najar-Peerayeh S. Heterogeneity of cytolethal distending toxin sequence types of Campylobacter jejuni and correlation to invasion/cytotoxicity potential: the first molecular survey from Iran. Microb Pathog. 2018 Jan; 114:213-8. DOI
- Oh E, McMullen LM, Chui L, Jeon B. Differential survival of hyper-aerotolerant Campylobacter jejuni under different gas conditions. Front Microbiol. 2017 May; 8:954. DOI
- Wysok B, Wojtacka J, Kivisto R. Pathogenicity of Campylobacter strains of poultry and human origin from Poland. Int J Food Microbiol. 2020 Dec; 334:108830. DOI
- Guirado P, Iglesias-Torrens Y, Miro E, Navarro F, Attolini CS, Balsalobre C, et al. Host-associated variability of the cdtABC operon, coding for the cytolethal distending toxin, in Campylobacter jejuni. Zoonoses Public Health. 2022 Dec; 69(8):966-77. DOI
- Weis AM, Miller WA, Byrne BA, Chouicha N, Boyce WM, Townsend AK. Prevalence and pathogenic potential of Campylobacter isolates from free-living, human-commensal American crows. Appl Environ Microbiol. 2014 Mar; 80(5):1639-44. DOI
- Ehsannejad F, Sheikholmolooki A, Hassanzadeh M, Shojaei Kavan R, Soltani M. Detection of cytolethal distending toxin (cdt) genes of Campylobacter jejuni and coli in fecal samples of pet birds in Iran. Iran J Vet Med. 2015 Apr; 9(1):49-56. DOI
- Redondo N, Carroll A, McNamara E. Molecular characterization of Campylobacter causing human clinical infection using whole-genome sequencing: virulence, antimicrobial resistance and phylogeny in Ireland. PLoS One. 2019 Jul; 14(7):e0219088. DOI
- Iglesias-Torrens Y, Miro E, Guirado P, Llovet T, Munoz C, Cerda-Cuellar M, et al. Population structure, antimicrobial resistance, and virulence-associated genes in Campylobacter jejuni isolated from three ecological niches: gastroenteritis patients, broilers, and wild birds. Front Microbiol. 2018 Aug; 9:1676. DOI
- Hamidian M, Sanaei M, Bolfion M, Dabiri H, Zali MR, Walther-Rasmussen J. Prevalence of putative virulence markers in Campylobacter jejuni and Campylobacter coli isolated from hospitalized children, raw chicken, and raw beef in Tehran, Iran. Can. J. Microbiol. 2011 Feb; 57(2):143-8. DOI
- Wei B, Kang M, Jang HK. Genetic characterization and epidemiological implications of Campylobacter isolates from wild birds in South Korea. Transbound Emerg Dis. 2019 Jan; 66(1):56-65. DOI
- Ammar AM, El-Naenaeey EY, El-Malt RMS, El-Gedawy AA, Khalifa E, Elnahriry SS, et al. Prevalence, antimicrobial susceptibility, virulence and genotyping of Campylobacter jejuni with a special reference to the anti-virulence potential of eugenol and beta-resorcylic acid on some multi-drug resistant isolates in Egypt. Animals (Basel).. 2020 Dec; 11(1):3. DOI
- Kovacs JK, Cox A, Schweitzer B, Maroti G, Kovacs T, Fenyvesi H, et al. Virulence traits of inpatient Campylobacter jejuni isolates, and a transcriptomic approach to identify potential genes maintaining intracellular survival. Microorganisms. 2020 Apr; 8(4):531. DOI
- Datta S, Niwa H, Itoh K. Prevalence of 11 pathogenic genes of Campylobacter jejuni by PCR in strains isolated from humans, poultry meat and broiler and bovine faeces. J Med Microbiol. 2003 Apr; 52:345-8. DOI
- Yamazaki-Matsune W, Taguchi M, Seto K, Kawahara R, Kawatsu K, Kumeda Y, et al. Development of a multiplex PCR assay for identification of Campylobacter coli, Campylobacter fetus, Campylobacter hyointestinalis subsp. hyointestinalis, Campylobacter jejuni, Campylobacter lari and Campylobacter upsaliensis. J Med Microbiol. 2007 Nov; 56:1467-73. DOI
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute; 2020.
- Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012 Mar; 18(3):268-81. DOI
- Carvalho AC, Ruiz-Palacios GM, Ramos-Cervantes P, Cervantes LE, Jiang X, Pickering LK. Molecular characterization of invasive and Noninvasive Campylobacter jejuni and Campylobacter coli isolates. J Clin Microbiol. 2001 Apr; 39(4):1353-9. DOI
- Khoshbakht R, Tabatabaei M, Hosseinzadeh S. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of three lipooligosaccharide-associated genes of Campylobacter jejuni and Campylobacter coli isolated from animal samples. Avicenna J Clin Microb Infec. 2017 Aug; 4(3):e11983. DOI