Iranian Journal of Veterinary Science and Technology

Iranian Journal of Veterinary Science and Technology

Prevalence assessment of Salmonella serovars in apparently healthy pet dogs in Tehran, Iran

Document Type : Research Articles

Authors
1 Department of Microbiology and Immunology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran.
2 Department of Cell & Molecular Biology and Microbiology, Faculty of Biological Sciences and Technology, University of Isfahan, Isfahan, Iran.
Abstract
Salmonellosis is considered to be a zoonotic disease, the transmission of which through oral-fecal contact is unavoidable because pet care has been popular recently. On the other hand, excessive use of human antibiotics to treat animals resulted in the emergence of antibiotic-resistant Salmonella serotypes. This study aimed to assess the prevalence of bacteria and antibiotic resistance to select the appropriate antibiotic for disease control. In this study, the presence of Salmonella serovars in the fecal samples of 256 pet dogs was investigated by enrichment and selective culture. Moreover, the existence of virulence and antibiotic resistance genes, as well as phenotypic antimicrobial resistance, were assessed. Of the total of 256 fecal samples, 21 samples (8.2%) of pet dogs were positive for Salmonella, including S. Typhimurium, S. Enteritidis, S. Infantis, and S. Senftenberg. Based on our findings, all serovars carried virulence genes invA, invF, sitC, fimA and S. Typhimurium resistant to ampicillin (100%), tetracycline (50%), oxytetracycline (75%), florfenicol (50%) and lincospectin (100%). While S. enteritidis, S. infantis, and S. senftenberg were sensitive to ampicillin, amikacin, gentamicin, and ciprofloxacin. S. Infantis was also sensitive to all antibiotics. In conclusion, our findings suggest that pet dogs are potential sources of Salmonella strains that carry resistance and virulence genes. Thus, healthy pet dogs could play an important role in human salmonellosis. 
Keywords
Subjects

Abbreviations

S. Typhimurium: Salmonella typhimurium

S. Infantis: Salmonella infantis

S. Enteritidis: Salmonella enteritidis

S. Senftenberg: Salmonella senftenberg

Introduction

In developed countries, dogs are one of the most popular pet animals and the relationship between humans and pets has changed dramatically [ 1 ]. Direct contact of dogs and humans with food and feces transmits bacteria to humans that pose a greater potential risk to children than adults [ 2 ]. One of the most important zoonotic bacteria is Salmonella [ 2 , 3 ]. Salmonella is a gram-negative bacterium that includes endotoxins, enterotoxins, siderophores, flagella, and virulence plasmids. In humans and animals, this bacterium can cause gastroenteritis, pneumonia, abortion, and lethal sepsis. The Salmonella genus contains more than 2659 serovars [ 4 ].

Dogs are generally resistant to infection and and serve as carriers for human salmonellosis without any clinical symptoms. Indeed, most of antibiotic resistance genes identified in human infection are correlated with dog salmonellosis [ 5 , 6 ]. On the other hand, pet dogs could be an important source of antibiotic-resistant serovars. Therefore, these animals are considered a public health, particularly for children, the elderly, and immunocompromised individuals [ 7 - 9 ].

Salmonella serovar prevalence in dogs is influenced by several variables: First, environment, if they contact wild animals or infected animals. Second, raw food was already reported to have a high-risk factor in Salmonella serovars prevalence. Third, in microbiota alteration, normal microbiota could inhibit the gut tract from pathogen colonization while microbiota change can provide an environment for pathogen replacement [ 3 , 10 , 11 ].

Generally, Salmonella virulence factors, such as the invA, invF, sitC, and fimA, are chromosomal, while antibiotic resistance genes are located on plasmids. For example, β-lactams, aminoglycosides, tetracyclines, trimethoprim, and sulfonamide resistance-related genes (blaCMY-2, blaCMY-9, aac(3)-Ia, aac(3)-IIa, tetA, tetB, dhfrI, dhfrII, sulI, sulII) [ 12 - 15 ].

Salmonella is of high importance in public health and human diseases. Furthermore, the desire to have pet dogs is increasing in Iran. however, no recent research has evaluated the prevalence of Salmonella serovars in healthy dogs in Iran.

Therefore, the aim of this study was the assessment of the presence of Salmonella serovars in healthy pet dogs in Tehran, Iran. Moreover, the virulence factors and antibiotic resistance genes (mentioned above) were also evaluated.

Results

The prevalence of Salmonella serovars in healthy pet dogs

Isolation of Salmonella serovars was confirmed based on the cultural and biochemical methods. Out of the specimens collected from 256 dogs, 21 samples (8.2%) were positive for Salmonella (17 samples from Tehran University Veterinary Hospital and 4 samples from Khavarmiane Veterinary Hospital).

Isolated Salmonella serovars were serotyped with O and H antisera. Serotyping revealed four differents serovars: S. Typhimurium (n = 4); S. Infantis (n = 4); S. Enteritidis (n = 10) and S. Senftenberg (n = 3) (Table 1).

Salmonella Serovar Serogroup H1 H2 number number(%)
Salmonella typhimurium B (1,4,5,12) i 1,2 4 19.04
Salmonella infantis C1(6,7) b 1,2 4 19.04
Salmonella enteritidis D (1,9,12) g.m --- 10 47.61
Salmonella senftenberg E4(1,3,19) g.s.t --- 3 14.28
Total 21
Table 1.Salmonella serovars from dogs (n=21)

Detection of Salmonella virulence genes

The results of PCR amplification of the extracted DNA from 21 isolates on invA, invF, sitC, and fimA virulence genes showed that all samples (100%) had invA gene. Moreover, invF, sitC, and fimA genes were detected in 19 samples (90.47%). All virulence genes were detected in S. Typhimurium and S. Infantis (Table 2). All the samples of S. enteritidis serovar showed all virulence genes except one which was sitC-negative. In the S. Senftenberg serovar, two isolates were positive for sitC and one was positive for invF and fimA virulence genes (Table 3).

Virulence gene number number(%)
invA 21 100
invF 19 90.47
SitC 19 90.47
fimA 19 90.47
Table 2.Distribution of the virulence genes (n=21)
Salmonella Serovars virulence genes (%)
invA invF sitC fimA
Salmonella typhimurium 4(100%) 4(100%) 4(100%) 4(100%)
Salmonella infantis 4(100%) 4(100%) 4(100%) 4(100%)
Salmonella enteritidis 10(100%) 10(100%) 9(90%) 10(100%)
Salmonella senftenberg 3(100%) 1(33.33%) 2(66.66%) 1(33.33%)
Table 3.Presence of virulence genes in Salmonella serovars@Salmonella SerovarsVirulence genes

Antibiotic resistance genotype

The results of the detection of antibiotic resistance genes are shown in Table 4. The prevalence of antibiotic resistance genes was examined in different strains. All isolates of S. Typhimurium were positive (100%) for blaCMY-2, tet A, and sul I. For the other genes, fewer isolates were positive. Furthermore, in S. infantis, the most prevalent resistance genes were blaCMY-2, aac(3)-Ia, dhfrI, sul II, and tet A, while the least prevalent genes were sulI, dhfr II, tet B, and aac(3)-IIa. In S. enteritidis, the most prevalent resistance genes included aac(3)-IIa, tet B, and dhfrII, while tetA and aac(3)-Ia had a low prevalence. The lowest abundance of blaCMY-2, blaCMY-9, aac(3)-IIa, tet B, dhfrI, and sulII genes were detected in S. Septenberg.

Salmonella Serovars Antimicrobial resistance genes
blaCMY-2 blaCMY-9 aac(3)-Ia aac(3)-IIa tetA tetB dhfr I dhfr II Sul I Sul II
Salmonella typhimurium 4(100%) 3(75%) 3(75%) 0(0%) 4(100%) 2(50%) 3(75%) 1(25%) 4(100%) 0(0%)
Salmonella infantis 4(100%) 2(50%) 3(75%) 1(25%) 3(75%) 2(50%) 4(100%) 1(25%) 2(50%) 3(75%)
Salmonella enteritidis 9(90%) 6(60%) 6(60%) 4(40%) 5(50%) 6(60%) 7(70%) 4(40%) 6(60%) 9(90%)
Salmonella senftenberg 0(0%) 0(0 %) 2(66.6%) 0(0 %) 2(66.6%) 1(33.3%) 2(66.6%) 1(33.3%) 2(66.6%) 2(66.6%)
Table 4.Distribution of the antimicrobial resistance genes in Salmonella serovars

Antimicrobial resistance phenotypes

According to the results, S. Typhimurium was resistant to ampicillin (100%), Tetracycline (50%), Oxytetracycline (75%), Florfenicol (50%), and Lincospectin (100%). On the other hand, all isolates belonging to S. Enteritidis, S. Infantis and, S. Senftenberg were sensitive to Ampicillin, Amikacin, Gentamicin, and Ciprofloxacin. S. Infantis was also sensitive to all antibiotics (Table 5).

Antimicrobials strains S. Typhimurium S. Infantis S. Enteritidis S. Senftenberg
No. of strains 4 4 10 3
S I R S I R S I R S I R
AM 0 0 4 4 0 0 10 0 0 3 0 0
FOX 4 0 0 4 0 0 10 0 0 3 0 0
CPM 4 0 0 4 0 0 10 0 0 3 0 0
CEF 4 0 0 4 0 0 10 0 0 3 0 0
GEN 4 0 0 4 0 0 10 0 0 3 0 0
AMK 4 0 0 4 0 0 10 0 0 3 0 0
T 1 1 2 2 2 0 9 0 0 0 0 3
OTC 0 1 3 4 0 0 0 1 9 0 0 3
DOX 3 1 0 4 0 0 9 1 0 1 2 0
FLO 0 2 2 4 0 0 10 0 0 1 0 2
LS 0 0 4 4 0 0 9 0 1 3 0 0
ENR 4 0 0 4 0 0 10 0 0 3 0 0
CIP 4 0 0 4 0 0 10 0 0 3 0 0
TS 4 0 0 4 0 0 9 0 1 2 0 1
S is susceptible, I is intermediate resistance and R resistance. Antimicrobials: AM (ampicillin), FOX (Cefoxitin), CPM (cefepime), CEF (Ceftiofur), GEN (Gentamicin), AMK (Amikacin), T (Tetracycline), OTC (Oxytetracycline), DOX (Doxycycline), FLO (Florfenicol), LS (Lincospectin), ENR (Enrofloxacin), CIP (Ciprofloxacin), TS (Trimethoprim-Sulfamethoxazole).
Table 5.Antimicrobial resistance /susceptibility phenotypes of isolated Salmonella serovars

Discussion

Salmonella is one of the main causes of food poisoning, diarrhea, and gastroenteritis in humans [ 16 ]. Acute gastroenteritis is one of the most prevalent diseases in regions with low public health [ 17 ]. Salmonellosis is known as a common disease between humans and animals. Since keeping pets, especially dogs has become popular in recent years, the possibility of disease transmission through regular contact with feces (fecal-oral transmission) of animals is inevitable. In Iran, a significant percentage of gastroenteritis in children is related to Salmonella [ 18 - 20 ]. In recent years, the incidence of non-typhoid Salmonella has increased dramatically due to the emergence of many Salmonella serotypes [ 21 , 22 ].

The Salmonella serovars have been isolated from 0%-79% of healthy pet dogs in diverse regions of the world [ 5 , 6 , 23 , 24 ]. There are few studies on the infection of dogs with Salmonella in Iran. The first study in Tehran on outdoor dogs was carried out by Shimi et al. in 1976, it was shown that 15.8 % of dogs were infected with the serotypes of Salmonella Derby and Newport [ 25 ]. Zahraei Salehi et al. in 2013 found that 10.5% of dogs in Garmsar region were infected with S. Reading serotype [ 26 ]. Nimrodi et al. investigated dog feces specimens from ten rural areas of Mazandaran, Iran, and reported that 50%, 35%, and 15% of the isolates were S. Enteritidis, S. Typhimurium, and S. Dublin, respectively. The most frequent serovar in the latter study was S. Enteritidis [ 27 ]. In the present study, the prevalence of Salmonella serovars was 8.2% in Tehran. Four serovars were isolated, with S. Enteritidis (47.61%) and S. Typhimurium (19.04%) predominating as the major serovars associated with human disease. This difference in the prevalence of Salmonella first can be due to geographical variation [ 5 , 23 , 28 ] and then differences in the sample sizes, fecal sampling conditions, and isolation and detection methods employed. There have been many reports of different Salmonella serotypes being isolated worldwide from the feces of healthy dogs. About 53 serotypes were isolated, most of which were related to S. Typhimurium, S. Anatum, S. Panama, S. Krfeld, S. Bronx, S. Newport, S. Indiana, S. Kentucky, S. Saintpaul, and S. Virchow [ 29 , 30 ]. Unlike developing countries where the pet dogs are fed a commercial diet, the main dog food in Iran is cooked homemade food, such as rice and chicken. Nadi, et al. in a study on 1425 stool samples (obtained from Salmonella outbreaks, 2013-2019) revealed that S. Enteritidis and S. Senftenberg were major Salmonellosis agents in Iran with frequencies of 26.3% and 21.3%, respectively [ 31 ]. A study conducted by Chantharothaiphaichit that healthy household dogs multidrug-resistant Salmonella Enterica [ 32 ].

In the world, as well as in Iran, S. Enteritidis is the major salmonellosis agent with the food source [ 33 , 34 ]. Also, several studies have shown that a Salmonellosis agent was detected in cooked poultry and cooked meat [ 35 , 36 ]. According to previous studies, food is one of the main sources of Salmonella infection in pet dogs, which can infect humans. Moreover, in our research, all isolates were positive for invA virulence gene. This gene is an international standard for identifying Salmonella (Malorny, Hoorfar, Bunge, & Helmuth, 2003). A previous study in Iran reported that the frequency of virulence genes in 13 positive Salmonella samples was reported as follows: invA (100%), invF (23.1%), and sitC (0%). However, due to the lack of serotyping, these results are not reliable [ 13 ]. In England and Iraq, all isolates carried sitC and fimA [ 37 , 38 ] which is consistent with our finding.

Diarrhea is the most common symptom of human salmonellosis [ 39 , 40 ]. Therefore, the assessment of antibiotic resistance to Salmonella serovars in dogs is especially important. The genotype and phenotype of antibiotic resistance of serovars have been investigated in our research. All isolates of S. Typhimurium were resistant to third-generation Ampicillin. We also found that S. Typhimurium, S. Enteritidis, and S. Senftenberg were resistant to the Tetracycline group except for S. Infantis. Several studies have shown that Tetracycline/Oxytetracycline resistance in Salmonella serovars is common [ 40 , 41 ]. Fortunately, The first antibiotic choice for non-typhoid salmonellosis in humans is ciprofloxacin [ 42 ], to which all isolates were susceptible in the present study. Similar results were reported with our study on Salmonella isolates from around the world [ 31 , 43 - 45 ]. In conclusion, in the present study, it was shown that S. Enteritidis, S. Typhimurium, S. Infantis, and S. Senftenberg are the main serovars respectively in apparently healthy pet dogs in Tehran. The prevalence of Salmonella in the feces of pet dogs was evaluated to be 8.2%. Food is a possible contamination source in dogs. Isolated serovars have the potential to cause infection in humans. In this study, despite resistance to some antibiotic susceptibility to antimicrobials of choice for the treatment of human salmonellosis detected. Thus, our finding provided promising information on the prevalence of Salmonella serovars and their antibiotic resistance in pet dogs which can contaminate their owners. Regular monitoring of pet dogs can play an important role in controlling human Salmonellosis.

Sample collection

All animals were handled according to animal care rules of the Faculty of Veterinary Medicine, University of Tehran, Tehran. In this study, we used 206 fecal samples of pet dogs (age under 4 years, during 2000-2001) collected from the small animal hospital of Teheran University and 50 samples (age under 4 years, during 2020-2021) from Khavarmiane Veterinary Hospital, Tehran. The health conditions of the animals were checked and they did not show any specific symptoms of the disease. Rectal swabs were collected and transported under refrigeration to the microbiology laboratory of the Faculty of Veterinary Medicine, University of Tehran.

Salmonella serovars isolation and serotyping

Salmonella isolation was using a standard method (ISO 6579: 2002). Briefly, each rectal swab was enriched for 24 h at 37 °C in 1:10 vol/vol buffered Peptone water 2.5% (Merck, Germany). Then, 100 µl of the culture suspension was spotted on MacConkey agar (Merck, Germany) and incubated at 37 °C for 24 h. Next, Colonies were selected for inoculation onto Salmonella Shigella agar (SS agar, Merck, Germany) at 37 °C for 24 h. Salmonella suspicious colonies were biochemically confirmed by applying oxidase and catalase tests, triple sugar iron agar (TSI) test and IMViC group tests. After biochemical confirmation, the isolates were serotyped by specific antisera according to the manufacturer's instructions (BD Difco, USA).

DNA extraction

The Salmonella serovars DNA was extracted via the boiling method and the DNA samples were stored at -20 °C until analysis [ 46 ].

Primers

In this study, 14 primers were purchased from the Sina Clone company (Tehran, Iran). Four virulence-related genes, including invA, invF, sitC, and fimA (Table 6) and ten antibiotic resistance genes were examined and confirmed at NCBI and Primer-BLAST sites (Table 7).

Virulence factor Target virulence gene Sequence 5′ to 3′ Product size (bp) References
Invasion factor F invF F:AAGGGATCCATGTCATTTTCTGAAAGCGACAC 918 [ 13 ]
R: GTTGTAGGGAAAGCTTCTCCAGTAATG
Invasion factor A invA F: GTG AAA TTA TCG CCA CGT TCG GGC AA 284 [ 35 ]
R: TCA TCG CAC CGT CAA AGG AAC C
Salmonella iron transporter C sitC F: CAGTATATGCTCAACGCGATGTGGGTCTCC 250 [ 13 ]
R: CGGGGCGAAAATAAAGGCTGTGATGAAC
fimbrial protein A fimA F: CCT TTC TCC ATC GTC CTG AA 85 [ 35 ]
R: TGG TGT TAT CTG CCT GAC CA
Table 6.Primers used for the detection of Salmonella virulence genes
Antimicrobial Agent Target resistance gene Sequence 5′ to 3′ Product size (bp) References
β-lactam blaCMY-2 F: TGGCCGTTGCCGTTATCTAC 870 [ 13 ]
R: CCCGTTTTATGCACCCATGA
blaCMY-9 F: TCAGCGAGCAGACCCTGTTC 847
R: CTGGCCGGGATGGGATAGTT
Aminoglycoside aac(3)-Ia F: TGAGGGCTGCTCTTGATCTT 436 [ 13 ]
R: ATCTCGGCTTGAACGAATTG
aac(3)-IIa F: CGGCCTGCTGAATCAGTTTC 439
R: AAAGCCCACGACACCTTCTC
Tetracycline tetA F: GCGCCTTTCCTTTGGGTTCT 831 [ 13 ]
R: CCACCCGTTCCACGTTGTTA
tetB F: CCCAGTGCTGTTGTTGTCAT 723
R: CCACCACCAGCCAATAAAAT
Trimethoprim dhfrI F: CGGTCGTAACACGTTCAAGT 220 [ 13 ]
R: CTGGGGATTTCAGGAAAGTA
dhfrII F: AGTTTGCGCTTCCCCTGAGT 194
R: CTTAGGCCACACGTTCAAGTG
Sulfonamide sulI F: TCACCGAGGACTCCTTCTTC 331 [ 13 ]
R: CAGTCCGCCTCAGCAATATC
sulII F: CCTGTTTCGTCCGACACAGA 435
R: GAAGCGCAGCCGCAATTCAT
Table 7.Primers used for detection of antibacterial resistance genes in Salmonella serovars

Conventional PCR Assays

The PCR was run in 25 μl reaction mixture using the PCR master mix (Amplicon, Denmark). A total volume of 25 μl of reaction mixture contained 1μM primer, 3 μl template DNA, 7.5 μl sterile distilled water, and 12.5 μl master mix. Initial denaturation for detecting invA, invF, sitC, and blaCMY-9 genes was performed at 94 °C for 5 min followed by 34 cycles of amplification. The amplification cycle included the following 3 steps: 94 °C for 1 min (denaturation), 60 °C for 1 min (annealing), and 72 °C for 1 min (extension). The polymerase chain reaction for other genes was similar to the previous steps except that the annealing temperatures for fimA, aac(3)-Ia, dhfrI, and dhfrII genes was 55 °C for 1 min, for blaCMY-2 was 56 °C for 1 min, aac(3)-IIa 52 °C for 1 min, and for tetA, tetB, sulI, and sulII genes was 72 °C for 1 min. After 34 amplification cycles, the samples were retained at 72 °C for 5 min to ensure complete strand extension. The standard strain of Salmonella (microbial collection of the Faculty of Veterinary Medicine, Tehran university) was used as positive control and distilled water was used as negative control.

PCR Product analysis

Analyzing the PCR products completed by using 1% agarose gelstained with 0.5 μg/mL ethidium bromide. The PCR products were visualized by a UV transilluminator and photographed using a digital camera.

Antibiotic susceptibility

The antibiotic susceptibility of all isolates was tested according to the Clinical and Laboratory Standards Institute protocols [ 47 ]. The antibiotics selected to test Salmonella serovars. include Ampicillin (10 µg), Cefoxitin (30 μg), Cefepime (30 μg), Ceftiofur (30 μg), Gentamicin (10 µg), Amikacin (30 μg), Tetracycline (30 μg), Oxytetracycline (30 μg), Doxycycline (30 μg), Florfenicol (30 μg), Lincospectin (100 μg), Enrofloxacin (5 μg), Ciprofloxacin (5 μg), and Trimethoprim-Sulfamethoxazole (240+52 μg). The antibiotic discs were purchased from Padtan Teb company, and zone diameters were assessed and categorized as susceptible, intermediate, or resistant according to company guideline tables.

Authors' Contributions

AAK, RY, and TZS conceived and designed research. AAK, RY, TZS, IAT, and BB conducted experiments. AAK, BB, RY, and TZS analyzed data. AAK and BB wrote the manuscript. RY and TZS edited the manuscript. All authors read and approved the manuscript.

Acknowledgements

The authors would like to thank the Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran, and also Dr. Hossein Safari, Khavarmiane Veterinary Hospital chief for cooperating in preparing samples.

Competing Interests

The authors declare that they have no conflict of interest.

References

  1. Wallis LJ, Szabó D, Erdélyi-Belle B, et al. Demographic change across the lifespan of pet dogs and their impact on health status. Frontiers in Veterinary Science. 2018; 5:200.
  2. O’Neil J. Zoonotic infections from common household pets. The Journal for Nurse Practitioners. 2018; 14(5):363-370.
  3. Bataller E, García-Romero E, Llobat L, et al. Dogs as a source of Salmonella spp. in apparently healthy dogs in the Valencia Region. Could it be related with intestinal lactic acid bacteria?.. BMC Vet Res. 2020; 16(1):1-8.
  4. Ryan MP, O’Dwyer J, Adley CC. Evaluation of the complex nomenclature of the clinically and veterinary significant pathogen Salmonella. BioMed research international. 2017; 2017
  5. Lowden P, Wallis C, Gee N, et al. Investigating the prevalence of Salmonella in dogs within the Midlands region of the United Kingdom. BMC Vet Res. 2015; 11(1):239.
  6. Reimschuessel R, Grabenstein M, Guag J, et al. Multilaboratory survey to evaluate Salmonella prevalence in diarrheic and nondiarrheic dogs and cats in the United States between 2012 and 2014. J Clin Microbiol. 2017; 55(5):1350-1368.
  7. Yukawa S, Uchida I, Tamura Y, et al. Characterisation of antibiotic resistance of Salmonella isolated from dog treats in Japan. Epidemiol Infect. 2019; 147
  8. Wu X, Angkititrakul S, L Richards A, et al. Risk of Antimicrobial Resistant Non-Typhoidal Salmonella during Asymptomatic Infection Passage between Pet Dogs and Their Human Caregivers in Khon Kaen, Thailand. Antibiotics. 2020; 9(8):477.
  9. USA Food and Drug Administration F. Get the Facts About Salmonella! Anim Heal Lit. (2017). https://www.fdagov/animal-veterinary/animal-health-literacy/get-facts-about-salmonella 2020
  10. Davies R, Lawes J, Wales A. Raw diets for dogs and cats: a review, with particular reference to microbiological hazards. J Small Anim Pract. 2019; 60(6):329-339.
  11. Suchodolski JS. Intestinal microbiota of dogs and cats: a bigger world than we thought. Veterinary Clinics: Small Animal Practice. 2011; 41(2):261-272.
  12. Chiu C-H, Ou JT. Rapid identification of Salmonella serovars in feces by specific detection of virulence genes, invA and spvC, by an enrichment broth culture-multiplex PCR combination assay. J Clin Microbiol. 1996; 34(10):2619-2622.
  13. Torkan S, Khamesipour F, Anyanwu M. Detection of virulence and antibacterial resistance genes in Salmonella isolates from diarrhoeic dogs in Iran. Revue Méd Vét. 2015; 166:221-228.
  14. McMillan EA, Gupta SK, Williams LE, et al. Antimicrobial resistance genes, cassettes, and plasmids present in Salmonella enterica associated with United States food animals. Frontiers in microbiology. 2019; 10:832.
  15. Wei L, Yang C, Shao W, et al. Prevalence and drug resistance of Salmonella in dogs and cats in Xuzhou, China. Journal of Veterinary Research. 2020; 1(ahead-of-print)
  16. Amuasi JH, May J. Non-typhoidal salmonella: Invasive, lethal, and on the loose. The Lancet Infectious Diseases. 2019; 19(12):1267-1269.
  17. Ngogo FA, Abade AM, Rumisha SF, et al. Factors associated with Salmonella infection in patients with gastrointestinal complaints seeking health care at Regional Hospital in Southern Highland of Tanzania. BMC Infect Dis. 2020; 20(1):135.
  18. Harb A, O’Dea M, Abraham S, et al. Childhood Diarrhoea in the Eastern Mediterranean Region with Special Emphasis on Non-Typhoidal Salmonella at the Human–Food Interface. Pathogens. 2019; 8(2):60.
  19. Mahmoudi S, Pourakbari B, Moradzadeh M, et al. Prevalence and antimicrobial susceptibility of Salmonella and Shigella spp. among children with gastroenteritis in an Iranian referral hospital. Microb Pathog 2017; 109:45-48.
  20. Eshaghi Zadeh SH, Fahimi H, Fardsanei F, et al. Antimicrobial resistance and presence of class 1 integrons among different serotypes of Salmonella spp. recovered from children with diarrhea in Tehran, Iran. Infectious Disorders-Drug Targets (Formerly Current Drug Targets-Infectious Disorders). 2020; 20(2):160-166.
  21. Parisi A, Crump JA, Stafford R, et al. Increasing incidence of invasive nontyphoidal Salmonella infections in Queensland, Australia, 2007-2016. PLoS neglected tropical diseases. 2019; 13(3):e0007187.
  22. Marchello CS, Fiorino F, Pettini E, et al. Incidence of non-typhoidal Salmonella invasive disease: A systematic review and meta-analysis. Journal of Infection. 2021; 83(5):523-532.
  23. Marks SL, Rankin S, Byrne BA, et al. Enteropathogenic bacteria in dogs and cats: diagnosis, epidemiology, treatment, and control. J Vet Intern Med. 2011; 25(6):1195-1208.
  24. Finley R, Ribble C, Aramini J, et al. The risk of salmonellae shedding by dogs fed Salmonella-contaminated commercial raw food diets. The Canadian Veterinary Journal. 2007; 48(1):69.
  25. Shimi A, Keyhani M, Bolurchi M. Salmonellosis in apparently healthy dogs. The Veterinary record. 1976; 98(6):110.
  26. Salehi TZ, Badouei MA, Madadgar O, et al. Shepherd dogs as a common source for Salmonella enterica serovar Reading in Garmsar, Iran. Turkish Journal of Veterinary and Animal Sciences. 2013; 37(1):102-105.
  27. Namroodi S, Estaji H, M D. Frequency and Antimicrobial Resistance Pattern of Salmonella Spp in Asymptomatic Rural Dogs. J Mazandaran Univ Med Sci. 2016; 26(135):153-157.
  28. Leonard F. Salmonella infection and carriage: the importance of dogs and their owners. Vet Rec. 2014; 174(4):92-93.
  29. Kiflu B, Alemayehu H, Abdurahaman M, et al. Salmonella serotypes and their antimicrobial susceptibility in apparently healthy dogs in Addis Ababa, Ethiopia. BMC Vet Res. 2017; 13(1):134.
  30. Zahraei Salehi T. Salmonella. University of Tehran press. Tehran, Iran. 1999;24-29.
  31. Nadi ZR, Salehi TZ, Tamai IA, et al. Evaluation of antibiotic resistance and prevalence of common Salmonella enterica serovars isolated from foodborne outbreaks. Microchem J. 2020; 155:104660.
  32. Chantharothaiphaichit T, Phongaran D, Angkittitrakul S, et al. Clinically healthy household dogs and cats as carriers of multidrug-resistant Salmonella enterica with variable R plasmids. J Med Microbiol. 2022; 71(2):001488.
  33. Pardo G, Cerdán M, JM JV. Salmonella enteritidis bacteraemia as clinical onset of acquired immune deficiency syndrome. Revista Espanola de Anestesiologia y Reanimacion. 2012; 60(2):103-105.
  34. Fardsanei F, Dallal MMS, Douraghi M, et al. Antimicrobial resistance, virulence genes and genetic relatedness of Salmonella enterica serotype Enteritidis isolates recovered from human gastroenteritis in Tehran, Iran. Journal of Global Antimicrobial Resistance. 2018; 12:220-226.
  35. Authority EFS. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food‐borne outbreaks in 2017. EFSa Journal. 2018; 16(12)
  36. Dallal MMS, Doyle MP, Rezadehbashi M, et al. Prevalence and antimicrobial resistance profiles of Salmonella serotypes, Campylobacter and Yersinia spp. isolated from retail chicken and beef, Tehran, Iran. Food Control. 2010; 21(4):388-392.
  37. Mather A, Lawson B, Wigley P, et al. Genomic analysis of $\textit {Salmonella enterica} $ serovar Typhimurium from wild passerines in England and Wales. 2016.
  38. Salih W, Yousif A. Molecular detection of Salmonella typhimurium isolated from canine feces by pcr. Adv Anim Vet Sci. 2018; 6(12):542-547.
  39. Soltan Dallal M, Khalilian M, Masoumi Asl H, et al. Molecular epidemiology and antimicrobial resistance of Salmonella spp. Isolated from resident patients in Mazandaran Province, Northern Iran. Journal of food quality and hazards control. 2016; 3(4):146-151.
  40. Vaez H, Ghanbari F, Sahebkar A, et al. Antibiotic resistance profiles of Salmonella serotypes isolated from animals in Iran: a meta-analysis. Iranian Journal of Veterinary Research. 2020; 21(3):188.
  41. Velasquez C, Macklin K, Kumar S, et al. Prevalence and antimicrobial resistance patterns of Salmonella isolated from poultry farms in southeastern United States. Poult Sci. 2018; 97(6):2144-2152.
  42. Kariuki S, Gordon MA, Feasey N, et al. Antimicrobial resistance and management of invasive Salmonella disease. Vaccine. 2015; 33:C21-C29.
  43. Drake M, Amadi V, Zieger U, et al. Prevalence of Salmonella spp. in cane toads (Bufo marinus) from Grenada, West Indies, and their antimicrobial susceptibility. Zoonoses and public health. 2013; 60(6):437-441.
  44. Peterson R, Hariharan H, Matthew V, et al. Prevalence, serovars, and antimicrobial susceptibility of Salmonella isolated from blue land crabs (Cardisoma guanhumi) in Grenada, West Indies. J Food Prot. 2013; 76(7):1270-1273.
  45. Amadi VA, Hariharan H, Arya G, et al. Serovars and antimicrobial resistance of non‐typhoidal Salmonella isolated from non‐diarrhoeic dogs in Grenada, West Indies. Veterinary Medicine and Science. 2018; 4(1):26-34.
  46. Youn S, Jeong O, Choi B, et al. Application of loop-mediated isothermal amplification with propidium monoazide treatment to detect live Salmonella in chicken carcasses. Poult Sci. 2017; 96(2):458-464.
  47. Weinstein M, Patel J, Bobenchik A. Clinical and laboratory standards institute. Performance standards for antimicrobial susceptibility testing. 2019;88-9.
Send comment about this article
Enter Name.
Enter a valid email address.
Enter a vaid affiliation.
Enter comments (At leaset 10 words)
CAPTCHA Image
Enter Security Code Correctly.

  • Receive Date 01 December 2021
  • Revise Date 16 April 2022
  • Accept Date 19 April 2022